G2330931



Basic Information


Item Value
gene id G2330931
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493658.1
NCBI id JAAXML020000857.1
chromosome length 2864942
location 1185643 ~ 1188449 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2665822
aggctagccattcgtgcgtaacaagagtgcttatcgactcccacccacttgtttctttcacgcacaactattttaaagttgacaagggaggagtgtgtcactgcaaaatctaggtaggtcctaccgagatttgaactccgatcgcaggattcagagtcctgagtgctaaccattacaccatagaaccctatacagagtaattattgtagacttccgattttcctgtcatttgtacaccggataaacagcagattatgagattattggttggccatgtgaataattcagcacaaaaaataggaaggttctaccgagatttgaactcggatcactggattcaaagtccagagtgctaaccattacaccatagaaccatattctaaatcaacatggaaattgaaaaaaaaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2665822 True 408 lncRNA 0.40 2 1185643 1188449
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110513306 LOC105006014 coding downstream 72267 1098558 ~ 1113376 (-)
LOC110513304 NA coding downstream 107069 1077670 ~ 1078814 (-)
LOC118946760 LOC106610545 coding downstream 236155 806485 ~ 949488 (-)
LOC110519451 NA coding downstream 389661 733803 ~ 805684 (-)
LOC118946761 NA coding downstream 681044 500426 ~ 504599 (-)
LOC110513705 exosc9 coding upstream 4315 1192764 ~ 1202030 (-)
LOC110511394 LOC106591068 coding upstream 38962 1227411 ~ 1236818 (-)
LOC110513025 exosc9 coding upstream 196811 1385260 ~ 1393716 (-)
LOC110518942 LOC106591068 coding upstream 230392 1418841 ~ 1426336 (-)
LOC118946762 LOC106591691 coding upstream 705918 1875707 ~ 1896708 (-)
G2330933 NA non-coding downstream 40203 1123988 ~ 1145440 (-)
G2330924 NA non-coding downstream 63738 1119718 ~ 1121905 (-)
G2330895 NA non-coding downstream 104442 1079803 ~ 1081201 (-)
G2330887 NA non-coding downstream 131975 1052532 ~ 1053668 (-)
G2331309 NA non-coding upstream 35633 1224082 ~ 1414625 (-)
G2331305 NA non-coding upstream 36959 1225408 ~ 1425079 (-)
G2331310 NA non-coding upstream 63202 1251651 ~ 1271417 (-)
G2331346 NA non-coding upstream 79490 1267939 ~ 1428158 (-)
G2331351 NA non-coding upstream 91944 1280393 ~ 1287965 (-)
G2330705 LOC106597013 other downstream 500813 664211 ~ 684830 (-)
G2330702 NA other downstream 550764 633911 ~ 634879 (-)
G2330314 NA other downstream 1144533 39516 ~ 41110 (-)
G2331536 LOC106601386 other upstream 762648 1951097 ~ 1993315 (-)
G2331554 LOC106601385 other upstream 849438 2037887 ~ 2039068 (-)

Expression


G2330931 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2330931 Expression in each Bioproject

Bar chart with 4 bars.
G2330931 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network