G2330966



Basic Information


Item Value
gene id G2330966
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493658.1
NCBI id JAAXML020000857.1
chromosome length 2864942
location 1206366 ~ 1208980 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2665874
actataatctgatctatgatgttggttaatcccagatctgttggtgttgttactataatctgatctgtgatgttggttagtcccagatctgttggtgttgttactataatctgattactagtcccagatctgttggtgttgttactataatctgatctgtgatgttggttagtcccagatctgttggtgttgttactataatctgatctgtgatgttggttagtcccagatctgttggtgttgttactataatctgatctgtgatgttggttagtcccagatctgttggtgttactataatctgatctgtgatgttggttagtcccagatctgttggtgttgttactataatctgatctgtgatgttggttagtcccagatctgttggtgttgttactataatctgatctgtgatgttggttagtcccagatctgttggtgttgttactataatctgatctgtgatgt

Function


NR:

description
PREDICTED: uncharacterized protein LOC106574600

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2665874 True 468 lncRNA 0.38 2 1206366 1208980
Loading

Neighbor


gene id symbol gene type direction distance location
trnaq-cug-214 NA coding upstream 14831 1191464 ~ 1191535 (+)
trnai-aau-87 NA coding upstream 15170 1191123 ~ 1191196 (+)
trnaq-cug-213 NA coding upstream 15543 1190752 ~ 1190823 (+)
trnaq-cug-212 NA coding upstream 15875 1190420 ~ 1190491 (+)
trnaq-uug-224 NA coding upstream 16051 1190244 ~ 1190315 (+)
trnai-aau-88 NA coding downstream 29587 1238567 ~ 1238640 (+)
trnai-aau-89 NA coding downstream 31011 1239991 ~ 1240064 (+)
trnai-aau-90 NA coding downstream 32024 1241004 ~ 1241077 (+)
trnai-aau-91 NA coding downstream 33220 1242200 ~ 1242273 (+)
trnai-aau-92 NA coding downstream 34804 1243784 ~ 1243857 (+)
G2330965 NA non-coding upstream 4381 1201351 ~ 1201985 (+)
G2330910 NA non-coding upstream 17461 1128216 ~ 1188905 (+)
G2330911 NA non-coding upstream 60331 1124037 ~ 1146035 (+)
G2330909 NA non-coding upstream 80135 1121153 ~ 1126231 (+)
G2330905 NA non-coding upstream 92220 1113916 ~ 1114146 (+)
G2330967 NA non-coding downstream 1750 1210730 ~ 1211109 (+)
G2330970 NA non-coding downstream 21825 1230805 ~ 1231225 (+)
G2330975 NA non-coding downstream 27654 1236634 ~ 1426923 (+)
G2330977 NA non-coding downstream 28692 1237672 ~ 1239266 (+)
G2330976 NA non-coding downstream 30516 1239496 ~ 1271423 (+)
G2330613 NA other upstream 254959 950910 ~ 951407 (+)
G2330510 NA other upstream 427894 643138 ~ 778472 (+)
G2330523 LOC106601385 other upstream 476943 728306 ~ 729423 (+)
G2330497 LOC106601385 other upstream 664960 540240 ~ 541406 (+)
LOC110497192 LOC106610553 other upstream 912666 274893 ~ 293700 (+)
G2331026 NA other downstream 171367 1380347 ~ 1380812 (+)
G2330948 NA other downstream 175937 1384917 ~ 1386501 (+)
LOC110517176 maml3 other downstream 330351 1539302 ~ 1848885 (+)
G2331702 NA other downstream 1204074 2413054 ~ 2414407 (+)

Expression


G2330966 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2330966 Expression in each Bioproject

Bar chart with 17 bars.
G2330966 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network