G2331615


Basic Information

Item Value
gene id G2331615
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493658.1
NCBI id JAAXML020000857.1
chromosome length 2864942
location 2224723 ~ 2225809 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2666807
gtctgtctgtctgtctgcctgtctgtctgcctgcctgtgtgtgtctgtgtgtgtctgtgtatccgtctgtctgtctgtctgtctgtctgtgtgtgggtgtatgtcaaatcaaattgtattagtaaaattcgctgaatacaacaggtgtagtagacctcacagtgaaatgctgaataaaacaggtgtagacctcacagtgaaatgctgagtacaacaggggtagtagacctcacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagacctcacagtgaaatgctgaatacaacaggtgtagacctcacagtgaaatgctgaatacaacaggtgtagtagacctcacagtgaaatgctgaataaaacaggtgtag

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2666807 True 483 lncRNA 0.43 2 2224723 2225809

Neighbor

gene id symbol gene type direction distance location
LOC110497191 LOC106597766 coding downstream 48107 2154735 ~ 2176616 (-)
LOC118946763 LOC106591540 coding downstream 212242 2009540 ~ 2012481 (-)
LOC110511350 LOC106601386 coding downstream 271157 1934506 ~ 1953566 (-)
LOC118946762 LOC106591691 coding downstream 328015 1875707 ~ 1896708 (-)
LOC110518942 LOC106591068 coding downstream 798387 1418841 ~ 1426336 (-)
LOC118946770 NA coding upstream 13153 2238654 ~ 2239683 (-)
G2331616 NA non-coding downstream 1184 2222607 ~ 2223539 (-)
G2331613 NA non-coding downstream 5573 2218501 ~ 2219150 (-)
G2331612 NA non-coding downstream 7847 2215266 ~ 2216876 (-)
G2331606 NA non-coding downstream 43364 2180949 ~ 2181359 (-)
G2331602 NA non-coding downstream 52673 2170279 ~ 2172050 (-)
G2331631 NA non-coding upstream 42173 2267982 ~ 2270318 (-)
G2331650 NA non-coding upstream 96459 2322268 ~ 2322663 (-)
G2331654 NA non-coding upstream 102723 2328532 ~ 2329285 (-)
G2331657 NA non-coding upstream 112006 2337815 ~ 2338185 (-)
G2331554 LOC106601385 other downstream 185655 2037887 ~ 2039068 (-)
G2331536 LOC106601386 other downstream 231408 1951097 ~ 1993315 (-)
G2331305 NA other downstream 799644 1225408 ~ 1425079 (-)
LOC110513705 exosc9 other downstream 1022737 1192764 ~ 1202030 (-)
G2331771 NA other upstream 316233 2542042 ~ 2544584 (-)
G2331942 LOC106602138 other upstream 581163 2755110 ~ 2809111 (-)

Expression

G2331615 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2331615 Expression in each Bioproject

Bar chart with 16 bars.
G2331615 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network