Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G2334796

Basic Information

Item	Value
gene id	G2334796
gene name	NA
gene type	non-coding
species	rainbow trout (Oncorhynchus mykiss)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	NW_023493660.1
NCBI id	JAAXML020000588.1
chromosome length	1886234
location	1474412 ~ 1474618 (+)
genome version	USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2671388
TGGTCTGTTTCTGTCTTCTTCACCGACAGGGGAAGATCCTTCTTATTTAAAGTATAGGTACAATGGGAAAGTATTCAATTTGATTAACTTTGTCAAATTTACCAATTAAAAAAACCCAACTAGGACAAAAGGAATGTTTCAGGTTGGTAAACTCTATTACATAATTCCCTCATCACCTGGTCATTATATAAACATCATGTATATAAA

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU2671388	True	207	lncRNA	0.32	1	1474412	1474618

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
LOC118947021	reep3	coding	upstream	101045	1329818 ~ 1373367 (+)
LOC110515544	LOC106613891	coding	upstream	398433	1066693 ~ 1076882 (+)
LOC110511817	LOC106591225	coding	upstream	472498	1000321 ~ 1002185 (+)
LOC110513287	arid5b	coding	upstream	560387	813079 ~ 914025 (+)
cabcoco1	LOC106604008	coding	upstream	703927	756387 ~ 770485 (+)
LOC110515857	LOC106611092	coding	downstream	220319	1694937 ~ 1736967 (+)
LOC110515110	rgs7	coding	downstream	304823	1779441 ~ 1835837 (+)
G2334795	NA	non-coding	upstream	480	1473725 ~ 1473932 (+)
G2334791	LOC106577307	non-coding	upstream	7218	1465988 ~ 1467194 (+)
G2334788	NA	non-coding	upstream	18199	1455905 ~ 1456213 (+)
G2334780	NA	non-coding	upstream	87453	1386672 ~ 1386959 (+)
G2334748	NA	non-coding	upstream	106369	1367399 ~ 1368043 (+)
G2334798	NA	non-coding	downstream	2891	1477509 ~ 1477834 (+)
G2334806	NA	non-coding	downstream	8829	1483447 ~ 1483967 (+)
G2334807	NA	non-coding	downstream	9689	1484307 ~ 1484676 (+)
G2334809	NA	non-coding	downstream	15837	1490455 ~ 1491071 (+)
G2334811	NA	non-coding	downstream	19659	1494277 ~ 1495389 (+)
G2333977	NA	other	upstream	990896	483086 ~ 483516 (+)
G2333965	NA	other	upstream	1010421	459378 ~ 463991 (+)

Expression

Co-expression Network