G2334933


Basic Information

Item Value
gene id G2334933
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493660.1
NCBI id JAAXML020000588.1
chromosome length 1886234
location 1476641 ~ 1476998 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2671567
AGCTAGGAGCATCAACCACAGGACACTTTAGAGAACAACGGACACAACTGGCTAGCTCGGAGCATCAACCACAGGGCGCTTTAGAGAGAAACGGACCCAACTGGGCATCAGGGCTAGCTAGGAGCATCAACCACAGGGCGCTTTTTTCCTTAGGTACTGGTCCTCCTTAGGACCTGGTCCTCCTTAGGTACTGGTCCTCCTTAGGACCTGGTCCTCCTTAGGTACTGGTCCTCCTTAGGTTCTGATCCTCCTTAGGTACTGGTCCTCCTTAGG

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2671567 True 273 lncRNA 0.53 2 1476641 1476998

Neighbor

gene id symbol gene type direction distance location
LOC110515447 LOC106577307 coding downstream 5955 1465985 ~ 1470686 (-)
LOC110517734 LOC106594629 coding downstream 161387 1089558 ~ 1315254 (-)
LOC110512060 LOC100194495 coding downstream 465566 1007956 ~ 1011075 (-)
LOC118947020 LOC106593625 coding downstream 721347 748089 ~ 755294 (-)
LOC110514595 LOC106604002 coding downstream 728187 658355 ~ 748454 (-)
LOC110511642 exoc6 coding upstream 11785 1488783 ~ 1616529 (-)
LOC118947025 NA coding upstream 95544 1572542 ~ 1573131 (-)
LOC118936241 hhex coding upstream 209315 1686313 ~ 1689327 (-)
G2334931 NA non-coding downstream 1727 1474578 ~ 1474914 (-)
G2334929 NA non-coding downstream 5545 1470868 ~ 1471096 (-)
G2334928 NA non-coding downstream 11827 1464350 ~ 1464814 (-)
G2334926 NA non-coding downstream 12376 1464059 ~ 1464265 (-)
G2334785 NA non-coding downstream 86853 1389584 ~ 1389788 (-)
G2334916 NA non-coding upstream 5739 1482737 ~ 1483366 (-)
G2334918 NA non-coding upstream 6725 1483723 ~ 1483975 (-)
G2334936 NA non-coding upstream 16054 1493052 ~ 1494936 (-)
G2334940 NA non-coding upstream 20577 1497575 ~ 1499015 (-)
G2334944 NA non-coding upstream 30677 1507675 ~ 1508550 (-)
G2334652 NA other downstream 388820 1087239 ~ 1087821 (-)
G2334145 NA other downstream 944384 530464 ~ 532257 (-)
G2334064 NA other downstream 1200360 275147 ~ 276281 (-)

Expression

G2334933 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2334933 Expression in each Bioproject

Bar chart with 8 bars.
G2334933 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network