Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G2334905

Basic Information

Item	Value
gene id	G2334905
gene name	NA
gene type	non-coding
species	rainbow trout (Oncorhynchus mykiss)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	NW_023493660.1
NCBI id	JAAXML020000588.1
chromosome length	1886234
location	1691495 ~ 1691713 (+)
genome version	USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2671526
CTATATTCACTGAAGCTGCAATTTTGTAACTCGGCTCTTTTCAGCTCTTCTAACAGTTATTTTTCTTTGTCTTGATGCAAAATTGTGCCGCAAAGCTGAAATCCCATTGACAATAGTTCCACTGATTAGCCGATTCGATTTTTCTACAAGCGAGTCACTCCAATAAAGGGAACTTTCTAACGTCGTAATTTAGATAAAAGAGACCCGAAGAATAAACAC

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU2671526	True	219	lncRNA	0.37	1	1691495	1691713

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
LOC118947021	reep3	coding	upstream	318128	1329818 ~ 1373367 (+)
LOC110515544	LOC106613891	coding	upstream	615516	1066693 ~ 1076882 (+)
LOC110511817	LOC106591225	coding	upstream	689581	1000321 ~ 1002185 (+)
LOC110513287	arid5b	coding	upstream	777470	813079 ~ 914025 (+)
cabcoco1	LOC106604008	coding	upstream	921010	756387 ~ 770485 (+)
LOC110515857	LOC106611092	coding	downstream	3224	1694937 ~ 1736967 (+)
LOC110515110	rgs7	coding	downstream	87728	1779441 ~ 1835837 (+)
G2334901	NA	non-coding	upstream	5748	1685177 ~ 1685747 (+)
G2334900	NA	non-coding	upstream	6345	1684688 ~ 1685150 (+)
G2334899	NA	non-coding	upstream	7222	1680277 ~ 1684273 (+)
G2334898	NA	non-coding	upstream	7865	1678979 ~ 1683630 (+)
G2334890	NA	non-coding	upstream	25580	1661008 ~ 1665915 (+)
G2335028	NA	non-coding	downstream	64327	1756040 ~ 1756328 (+)
G2335029	NA	non-coding	downstream	66041	1757754 ~ 1758314 (+)
G2335036	NA	non-coding	downstream	74092	1765805 ~ 1766612 (+)
G2335041	NA	non-coding	downstream	80093	1771806 ~ 1772298 (+)
G2335050	NA	non-coding	downstream	83423	1775136 ~ 1775584 (+)
G2333977	NA	other	upstream	1207979	483086 ~ 483516 (+)
G2333965	NA	other	upstream	1227504	459378 ~ 463991 (+)

Expression

Co-expression Network