G2336611



Basic Information


Item Value
gene id G2336611
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493662.1
NCBI id JAAXML020000566.1
chromosome length 1797194
location 685106 ~ 704984 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2674245
gtgtgtcccaacttttgactggtcctgtagttTCTGTAGTGCAGAAAGTATGATGCTGTCCTAGTTCTGCTCTGTGTTCTGCTCCAAGGAAAGACTCATCTCTGGACACTCTCACATACCCTGTTACCTACTGCACTACTCCCCgcctgctctggtctgtctctcccagtctggtacaggtgtcctctcctgctctggtctgtctctcccagtctggtacaggtgtcctctcctgctctggtctgtctctcccaccccaccctcttcaacatatatatcaacgaattggcgcgggcactagaaaagtctgcagcacccggcctccccctgct
>TU2674244
ggattctccaattacattgaatgagttacaggacaaaataaaaaccctccaacccaaaaagtgtcaaattggctttttaccaaattaccgtacaacagaccatgtattcaccctacacaccctaattgacaaccaaacaaaccaaaacaaaggcaaagtcttctcatgctttgttgatttcaaaaaagccttcgactcaatctggcatgagggtctgctatacaaactgatggaaagtggtgttgggggtaaaacatacaacattataaaatccatgtacacaaacaacaagtgtgcggttaaaattggcaaaaaacacacatttcttcacacagggtcgtggggttagacagggatgcagcttaagccccaccctcttcaacatatatatcaacgaattggcgcgggcactagaaaagtctgcagcacccggcctccccctgct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2674245 False 332 lncRNA 0.54 2 685106 704984
TU2674244 True 445 lncRNA 0.42 2 704261 704984

Neighbor


gene id symbol gene type direction distance location
LOC110516269 NA coding upstream 2114 666560 ~ 682992 (+)
LOC110519397 NA coding upstream 42952 640728 ~ 642816 (+)
LOC118947079 NA coding upstream 111692 516802 ~ 573414 (+)
LOC118947097 NA coding upstream 154907 527708 ~ 530199 (+)
LOC110511244 NA coding upstream 223031 454447 ~ 462075 (+)
LOC110518290 LOC106561472 coding downstream 50812 755796 ~ 800920 (+)
LOC110491257 NA coding downstream 84550 789534 ~ 892453 (+)
LOC110517712 LOC106574369 coding downstream 134555 839539 ~ 866848 (+)
LOC110499824 NA coding downstream 249793 954777 ~ 960598 (+)
LOC118947076 NA coding downstream 332373 1037357 ~ 1037794 (+)
G2336306 LOC106599393 non-coding upstream 25622 268129 ~ 659484 (+)
G2336393 LOC106587644 non-coding upstream 26706 559825 ~ 658400 (+)
G2336604 NA non-coding upstream 29045 655766 ~ 656061 (+)
G2336595 NA non-coding upstream 45275 638356 ~ 639831 (+)
G2336301 NA non-coding downstream 1708 706692 ~ 731598 (+)
G2336619 NA non-coding downstream 5093 710077 ~ 711017 (+)
G2336436 NA non-coding downstream 24483 729467 ~ 1189837 (+)
G2336397 LOC106587643 non-coding downstream 32785 737769 ~ 823788 (+)
G2336626 NA non-coding downstream 39394 744378 ~ 750596 (+)
LOC118947088 LOC106593566 other downstream 391229 1081089 ~ 1098264 (+)
G2336431 NA other downstream 650919 1355903 ~ 1389866 (+)
G2336736 NA other downstream 782480 1487464 ~ 1488419 (+)
G2336367 NA other downstream 873256 1578240 ~ 1581200 (+)
LOC110515277 NA other downstream 1052719 1741320 ~ 1761572 (+)

Expression


G2336611 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2336611 Expression in each Bioproject

Bar chart with 21 bars.
G2336611 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network