G2336853



Basic Information


Item Value
gene id G2336853
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493662.1
NCBI id JAAXML020000566.1
chromosome length 1797194
location 1774501 ~ 1774837 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2674568
gttaaactgtagtagggtccacatagatactagtcatgctggtgtagtctatagctgagctggttaaactgtaggagggtccacatagatactagtcatgctggtgtagtctatagctgagctggttaaactgtaaactgatttgttattaattacaattcaatacaatgttttaatcttgtacatttccatgaatcatgatgtctggtgttgatgtatattggttgtcattcagaaccattgatatgttttctcagttggttctctgtctctatgtaattctcctcagtatcattgatcagcttgttggctcggtcctaattgatgtgttctctgt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2674568 True 337 lncRNA 0.37 1 1774501 1774837

Neighbor


gene id symbol gene type direction distance location
LOC100136000 fintrim coding downstream 84027 1581271 ~ 1690474 (-)
LOC118947099 NA coding downstream 96613 1676883 ~ 1677888 (-)
LOC118947085 LOC106587646 coding downstream 175734 1527714 ~ 1598767 (-)
LOC118947092 NA coding downstream 246720 1518198 ~ 1527781 (-)
LOC110513725 NA coding downstream 271934 1493935 ~ 1502567 (-)
G2336932 NA non-coding downstream 532 1773281 ~ 1773969 (-)
G2336877 NA non-coding downstream 1317 1772644 ~ 1773184 (-)
G2336884 NA non-coding downstream 2469 1770509 ~ 1772032 (-)
G2336916 NA non-coding downstream 10049 1762166 ~ 1764452 (-)
G2337380 NA non-coding downstream 34654 1739500 ~ 1739847 (-)
G2336914 NA non-coding upstream 562 1775399 ~ 1775692 (-)
G2337385 NA non-coding upstream 1240 1776077 ~ 1776374 (-)
G2336788 NA non-coding upstream 1924 1776761 ~ 1777917 (-)
G2337366 NA other downstream 128655 1645474 ~ 1645846 (-)
G2337349 NA other downstream 196503 1576712 ~ 1591372 (-)
G2336998 NA other downstream 258225 1515118 ~ 1516276 (-)
G2337292 LOC106584805 other downstream 489727 1282817 ~ 1284774 (-)

Expression


G2336853 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2336853 Expression in each Bioproject

Bar chart with 18 bars.
G2336853 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network