G2339158



Basic Information


Item Value
gene id G2339158
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493664.1
NCBI id JAAXML020000507.1
chromosome length 1504970
location 1111179 ~ 1121122 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2677971
gctcctctctctatgctcctctctctatgctccggctcctctctctatgagtcggctcctctctctatgagtcggctcctctctctatgagtcggctcctctctctatgttcctctctctatgccccggctcctctctctatgccccggctcctctctatacgagtctgctcctctctctatgctcctctctctatgctccggctactctctatgctcctctctctatgctcctcgctctatgccccg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2677971 True 248 lncRNA 0.56 2 1111179 1121122

Neighbor


gene id symbol gene type direction distance location
LOC118947123 NA coding downstream 26396 1083692 ~ 1086303 (-)
LOC110518374 cpsf4 coding downstream 63000 1026745 ~ 1048179 (-)
LOC110513313 slc29a4 coding downstream 107995 973741 ~ 1003184 (-)
LOC110516334 LOC106594246 coding downstream 152700 855362 ~ 958479 (-)
LOC118947119 NA coding downstream 311163 799163 ~ 800016 (-)
LOC110516784 smcr8 coding upstream 36930 1158052 ~ 1183417 (-)
LOC110516509 llgl1 coding upstream 205546 1326668 ~ 1417783 (-)
LOC118947127 LOC106594823 coding upstream 315377 1436499 ~ 1488403 (-)
G2339157 NA non-coding downstream 5850 1097497 ~ 1105329 (-)
G2339154 NA non-coding downstream 20586 1090302 ~ 1090593 (-)
G2339146 NA non-coding downstream 32223 1075708 ~ 1078956 (-)
G2339139 NA non-coding downstream 37230 1073281 ~ 1073949 (-)
G2339155 LOC106594472 non-coding upstream 13300 1134422 ~ 1134754 (-)
G2339167 NA non-coding upstream 15273 1136395 ~ 1137043 (-)
G2339168 NA non-coding upstream 16272 1137394 ~ 1138351 (-)
G2339172 NA non-coding upstream 24395 1145517 ~ 1149117 (-)
G2339176 NA non-coding upstream 29691 1150813 ~ 1155809 (-)
G2339121 NA other downstream 111322 997931 ~ 1168624 (-)
G2339060 NA other downstream 142025 963149 ~ 969154 (-)
G2339109 NA other downstream 169287 940976 ~ 941892 (-)
G2339202 NA other upstream 114082 1235204 ~ 1235588 (-)
G2339205 NA other upstream 120952 1242074 ~ 1243382 (-)

Expression


G2339158 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2339158 Expression in each Bioproject

Bar chart with 13 bars.
G2339158 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network