G2339427



Basic Information


Item Value
gene id G2339427
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493665.1
NCBI id JAAXML020000242.1
chromosome length 1484196
location 289762 ~ 290111 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2678418
CATTAACGATACGTCATTAGATAGAGGTCATTAACGATACGTCATTAGATAAAGACAACATTAACGATACGTCATTAGATAAAGAGGTCATTAACGATACGTCATTAGATAAAGACAACATTAACGATACGTCATTAGATAAAGACAACATTAACGATACGTCATTAGATAAAGAGGTCATTAACGATACGTCATTAGATAAAGAGGTCATTAACGATACGTCATTAGAT

Function


NR:

description
PREDICTED: zinc finger protein 154-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2678418 True 230 lncRNA 0.32 2 289762 290111

Neighbor


gene id symbol gene type direction distance location
LOC118947129 NA coding downstream 305392 595503 ~ 596337 (+)
LOC110495334 LOC106575937 coding downstream 472468 762579 ~ 768787 (+)
si:ch73-41e3.7 NA coding downstream 521376 811487 ~ 817841 (+)
LOC118947137 NA coding downstream 655341 945293 ~ 946912 (+)
tpp2 tpp2 coding downstream 689482 979593 ~ 1046298 (+)
G2339424 NA non-coding upstream 6223 282752 ~ 283539 (+)
G2339395 NA non-coding upstream 85495 202965 ~ 204267 (+)
G2339376 NA non-coding upstream 115940 169039 ~ 173822 (+)
G2339371 NA non-coding upstream 128004 160850 ~ 161758 (+)
G2339358 NA non-coding upstream 158081 127299 ~ 131681 (+)
G2339348 NA non-coding downstream 18341 308452 ~ 308783 (+)
G2339431 NA non-coding downstream 19353 309464 ~ 309943 (+)
G2339434 NA non-coding downstream 34228 324339 ~ 325971 (+)
G2339465 NA non-coding downstream 134481 424592 ~ 424824 (+)
G2339466 NA non-coding downstream 136139 426250 ~ 426645 (+)
G2339343 NA other upstream 191906 97115 ~ 97856 (+)
G2339478 NA other downstream 173087 463198 ~ 464467 (+)
G2339795 NA other downstream 393233 683344 ~ 685548 (+)
G2339912 NA other downstream 580996 870947 ~ 900840 (+)
G2339955 NA other downstream 682368 972479 ~ 972783 (+)
G2340118 NA other downstream 826832 1116943 ~ 1118969 (+)

Expression


G2339427 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2339427 Expression in each Bioproject

Bar chart with 7 bars.
G2339427 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network