G2339734


Basic Information

Item Value
gene id G2339734
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493665.1
NCBI id JAAXML020000242.1
chromosome length 1484196
location 519268 ~ 521952 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2678824
agtagaggtgtagaccttgttagatggtttagtagaggcccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtccttgttagatggtttagtagaggcccttgttagatggtttagtagaggcccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttggtggatggtttagtagaggtgtagaccttgttagatggtttagtagagt
>TU2678823
tagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggcccttgttagatggtttagtagaggtgtggaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggcccttgttagatggtttagtagaggcccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtaTAGACCTTGTTAGTTGgtttagtagaggtgtagaccttgttagatggtttagtagaggtgAAGACCTTGTTAGAGGgtttagtagaggtgtagaccttgttagatggtttagtagaggtccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggttCAGTAGAGGcccttgtt
>TU2678826
agtagaggtgtagaccttgttagatggtttagtagaggcccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtccttgttagatggtttagtagaggcccttgttagatggtttagtagaggcccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtaTAGACCTTGTTAGTTGgtttagtagaggtgtagaccttgttagatggtttagtagaggtgAAGACCTTGTTAGAGGgtttagtagaggtgtagaccttgttagatggtttagtagaggtccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggtttagtagaggtgtagaccttgttagatggttCAGTAGAGGcccttgtt

Function

NR:

description
PREDICTED: mucin-19-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2678824 False 318 lncRNA 0.42 3 519268 521952
TU2678823 False 556 lncRNA 0.41 3 519735 521571
TU2678826 True 531 lncRNA 0.41 3 519735 521952

Neighbor

gene id symbol gene type direction distance location
LOC118947133 NA coding upstream 165744 687696 ~ 688516 (-)
LOC118947134 NA coding upstream 184598 706550 ~ 724423 (-)
LOC110495337 cenpq coding upstream 252730 774682 ~ 796646 (-)
mrpl16 mrpl16 coding upstream 276342 798294 ~ 806925 (-)
txnl4b txnl4b coding upstream 296664 818616 ~ 832987 (-)
G2339724 NA non-coding downstream 32118 486667 ~ 487150 (-)
G2339723 NA non-coding downstream 33118 485697 ~ 486150 (-)
G2339722 NA non-coding downstream 33950 485096 ~ 485318 (-)
G2339721 NA non-coding downstream 37171 481891 ~ 482097 (-)
G2339716 NA non-coding downstream 46165 471726 ~ 473103 (-)
G2339759 NA non-coding upstream 76722 598674 ~ 599513 (-)
G2339765 NA non-coding upstream 91019 612971 ~ 613478 (-)
G2339767 NA non-coding upstream 93750 615702 ~ 617575 (-)
G2339770 NA non-coding upstream 98165 620117 ~ 622448 (-)
G2339775 NA non-coding upstream 120351 642303 ~ 643590 (-)
G2339563 NA other downstream 478590 40278 ~ 40678 (-)
ercc5 ercc5 other upstream 637007 1158959 ~ 1201980 (-)
LOC118947136 LOC106575928 other upstream 838648 1360510 ~ 1377938 (-)
G2340349 NA other upstream 867584 1389536 ~ 1392049 (-)
G2340359 NA other upstream 893804 1415756 ~ 1419633 (-)

Expression

G2339734 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G2339734 Expression in each Bioproject

Bar chart with 16 bars.
G2339734 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network