G2339790



Basic Information


Item Value
gene id G2339790
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493665.1
NCBI id JAAXML020000242.1
chromosome length 1484196
location 678319 ~ 678650 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2678895
TACACAATCACCTGTGGGTAATTTACACAATCACCTGTGCGTAATTTACACAATCACCTGTGGGTAATTTACACAATCACCTGTGGGTAATTTACACAATCACCTGTGGGTAATTTACACAATCACCTGTGGATAATTTACACAATCACCTGTGGGTAATTTACACAATCACCTGTGCGTAATTTACACAATCACCTGTGGGTAATTTACACAATCACCTGTGGGTAATTTACACAATCACCTGTGGGTAATTTACACAATCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2678895 True 263 lncRNA 0.38 2 678319 678650
Loading

Neighbor


gene id symbol gene type direction distance location
gpc5a gpc5 coding downstream 1464 369452 ~ 676855 (-)
LOC118947133 NA coding upstream 9046 687696 ~ 688516 (-)
LOC118947134 NA coding upstream 27900 706550 ~ 724423 (-)
LOC110495337 cenpq coding upstream 96032 774682 ~ 796646 (-)
mrpl16 mrpl16 coding upstream 119644 798294 ~ 806925 (-)
txnl4b txnl4b coding upstream 139966 818616 ~ 832987 (-)
G2339785 NA non-coding downstream 13909 663773 ~ 664410 (-)
G2339775 NA non-coding downstream 34729 642303 ~ 643590 (-)
G2339770 NA non-coding downstream 55871 620117 ~ 622448 (-)
G2339767 NA non-coding downstream 60744 615702 ~ 617575 (-)
G2339765 NA non-coding downstream 64841 612971 ~ 613478 (-)
G2339792 NA non-coding upstream 440 679090 ~ 680500 (-)
G2339796 NA non-coding upstream 2198 680848 ~ 682141 (-)
G2339806 NA non-coding upstream 10309 688959 ~ 690289 (-)
G2339821 NA non-coding upstream 25295 703945 ~ 704442 (-)
G2339563 NA other downstream 637641 40278 ~ 40678 (-)
ercc5 ercc5 other upstream 480309 1158959 ~ 1201980 (-)
LOC118947136 LOC106575928 other upstream 681950 1360510 ~ 1377938 (-)
G2340349 NA other upstream 710886 1389536 ~ 1392049 (-)
G2340359 NA other upstream 737106 1415756 ~ 1419633 (-)

Expression


G2339790 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2339790 Expression in each Bioproject

Bar chart with 13 bars.
G2339790 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network