Fish Transcriptome and Expression Database

trnaa-ugc-275

Item	Value
gene id	trnaa-ugc-275
gene name	NA
gene type	coding
species	rainbow trout (Oncorhynchus mykiss)
category of species	economic fish

Item	Value
chromosome id	NW_023493666.1
NCBI id	JAAXML020000359.1
chromosome length	1258143
location	1039670 ~ 1039741 (-)
genome version	USDA_OmykA_1.1_2020_rainbow_trout_Genome

>trnaa-ugc-275
ggggatgtagctcagtggtagagcgcatgctttgcatgtatgaggtcttgggttcaatccccagcttctcca

RNA id	representative	length	rna type	GC content	exon number	start site	end site
trnaa-ugc-275	True	72	mRNA	0.53	1	1039670	1039741

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

gene id	symbol	gene type	direction	distance	location
trnat-ugu-133	NA	coding	downstream	669	1038930 ~ 1039001 (-)
trnaa-cgc-68	NA	coding	downstream	1497	1038102 ~ 1038173 (-)
trnat-ugu-132	NA	coding	downstream	9137	1030462 ~ 1030533 (-)
trnaa-ugc-274	NA	coding	downstream	10603	1028996 ~ 1029067 (-)
trnat-ugu-131	NA	coding	downstream	11215	1028384 ~ 1028455 (-)
LOC118947143	LOC106595224	coding	upstream	1548	1041289 ~ 1043295 (-)
LOC118947154	NA	coding	upstream	13484	1053225 ~ 1053343 (-)
trnaf-gaa-186	NA	coding	upstream	20332	1060073 ~ 1060145 (-)
trnai-aau-177	NA	coding	upstream	20487	1060228 ~ 1060301 (-)
trnai-aau-178	NA	coding	upstream	22035	1061776 ~ 1061849 (-)
G2340949	NA	non-coding	downstream	47667	876032 ~ 992003 (-)
G2340974	NA	non-coding	downstream	104406	933491 ~ 935264 (-)
G2340968	NA	non-coding	downstream	118572	917005 ~ 921098 (-)
G2340897	NA	non-coding	downstream	220044	811254 ~ 819626 (-)
G2340903	NA	non-coding	downstream	221856	810062 ~ 817814 (-)
G2341021	NA	non-coding	upstream	19064	1058805 ~ 1115633 (-)
G2341025	NA	non-coding	upstream	20116	1059857 ~ 1064279 (-)
G2341020	NA	non-coding	upstream	28840	1068581 ~ 1074200 (-)
G2341032	NA	non-coding	upstream	78020	1117761 ~ 1120758 (-)
G2341059	NA	non-coding	upstream	144526	1184267 ~ 1184799 (-)
G2340951	NA	other	downstream	110538	878809 ~ 929132 (-)
G2340905	NA	other	downstream	225015	806890 ~ 814655 (-)
LOC110514508	LOC106595224	other	downstream	922954	114200 ~ 116716 (-)
G2340407	NA	other	downstream	976532	62414 ~ 63138 (-)
G2341053	NA	other	upstream	118857	1158598 ~ 1164054 (-)

species	gene id	symbol	gene type	chromosome	NCBI id	location
eurasian perch (Perca fluviatilis)	trnaq-cug_32	NA	coding	NC_053133.1	CM020930.1	1597378 ~ 1597450 (+)
tiger barb (Puntius tetrazona)	trnaa-ugc_105	NA	coding	NC_056704.1	CM032073.1	13461487 ~ 13461558 (-)