trnai-aau-204



Basic Information


Item Value
gene id trnai-aau-204
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493666.1
NCBI id JAAXML020000359.1
chromosome length 1258143
location 1106967 ~ 1107040 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnai-aau-204
ggctggttagctcagttggttagagtgtggtgctaataacgccaaggtcatgggttcgatccccgtactggcta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnai-aau-204 True 74 mRNA 0.53 1 1106967 1107040
Loading

Neighbor


gene id symbol gene type direction distance location
trnaf-gaa-202 NA coding downstream 83 1106812 ~ 1106884 (-)
trnai-aau-203 NA coding downstream 1039 1105855 ~ 1105928 (-)
trnaf-gaa-201 NA coding downstream 1195 1105700 ~ 1105772 (-)
trnaf-gaa-200 NA coding downstream 3399 1103496 ~ 1103568 (-)
trnaf-gaa-199 NA coding downstream 6928 1099967 ~ 1100039 (-)
trnai-aau-205 NA coding upstream 986 1108026 ~ 1108099 (-)
trnaf-gaa-203 NA coding upstream 1940 1108980 ~ 1109052 (-)
trnai-aau-206 NA coding upstream 2095 1109135 ~ 1109208 (-)
trnaf-gaa-204 NA coding upstream 4947 1111987 ~ 1112059 (-)
trnai-aau-207 NA coding upstream 5102 1112142 ~ 1112215 (-)
G2341020 NA non-coding downstream 32767 1068581 ~ 1074200 (-)
G2341025 NA non-coding downstream 42688 1059857 ~ 1064279 (-)
G2341006 NA non-coding downstream 66571 1005923 ~ 1040396 (-)
G2340949 NA non-coding downstream 114964 876032 ~ 992003 (-)
G2341032 NA non-coding upstream 10721 1117761 ~ 1120758 (-)
G2341059 NA non-coding upstream 77227 1184267 ~ 1184799 (-)
G2341069 NA non-coding upstream 121773 1228813 ~ 1229240 (-)
G2340951 NA other downstream 177835 878809 ~ 929132 (-)
G2340905 NA other downstream 292312 806890 ~ 814655 (-)
LOC110514508 LOC106595224 other downstream 990251 114200 ~ 116716 (-)
G2340407 NA other downstream 1043829 62414 ~ 63138 (-)
G2341053 NA other upstream 51558 1158598 ~ 1164054 (-)

Expression


trnai-aau-204 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network