XLOC_004239 (atp13a3)


Basic Information

Item Value
gene id XLOC_004239
gene name atp13a3
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 34151177 ~ 34151487 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00008094
AGGAGATTTTTTTTCGGTCTGAATGAAATTGATGTGAAAGTGCCTTCTCTTTTCAAGCTGCTAATTAAGGAGGTCCTCAATCCTTTCTACATCTTCCAGCTCTTCAGTGTTGTTCTGTGGTGTACAGATGAATACTATTACTACGCAATGGCCATAGTCGTCATGTCCTTCATATCAATAGCTACCTCTCTCTACACTATTAAAAAG

Function

symbol description
atp13a3 Predicted to enable ATP binding activity and metal ion binding activity. Predicted to act upstream of or within cation transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human ATP13A3 (ATPase 13A3).

GO:

id name namespace
GO:0006812 cation transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016887 ATPase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-120521-1 Predicted to enable ATP binding activity and metal ion binding activity. Predicted to act upstream of or within cation transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human ATP13A3 (ATPase 13A3).

Ensembl:

ensembl_id ENSDARG00000076622

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00008094 True 207 mRNA 0.39 2 34151177 34151487

Neighbor

gene id symbol gene type direction distance location
XLOC_004238 atp13a3 coding downstream 3972 34116734 ~ 34147205 (-)
XLOC_004237 tdo2b coding downstream 53740 34084532 ~ 34097437 (-)
XLOC_004236 col6a1 coding downstream 85459 33996526 ~ 34065718 (-)
XLOC_004235 NA coding downstream 158030 33992033 ~ 33993147 (-)
XLOC_004234 CR925698.1 coding downstream 184905 33966158 ~ 33966272 (-)
XLOC_004240 atp13a3 coding upstream 3106 34154593 ~ 34188346 (-)
XLOC_004241 tmem44 coding upstream 49696 34201183 ~ 34219211 (-)
XLOC_004242 lsg1 coding upstream 68504 34219991 ~ 34232906 (-)
XLOC_004243 FO681390.1 coding upstream 97969 34249456 ~ 34255220 (-)
XLOC_004244 NA coding upstream 164038 34315525 ~ 34358689 (-)
XLOC_004063 CR854846.1 misc downstream 18023499 16127382 ~ 16127678 (-)
XLOC_004019 CR450764.8 misc downstream 21459486 12691395 ~ 12691691 (-)
XLOC_004015 CR450764.4 misc downstream 21529410 12621518 ~ 12621767 (-)
XLOC_004013 CABZ01022569.1 misc downstream 21559881 12590999 ~ 12591296 (-)
XLOC_004008 BX000700.19 misc downstream 21637915 12512966 ~ 12513262 (-)
XLOC_004229 NA non-coding downstream 462228 33676834 ~ 33688949 (-)
XLOC_004227 NA non-coding downstream 749701 33305132 ~ 33401476 (-)
XLOC_004226 BX530032.2 non-coding downstream 952573 33190658 ~ 33198604 (-)
XLOC_004245 BX548160.1 non-coding upstream 204057 34355544 ~ 34355662 (-)
XLOC_004247 BX548160.2 non-coding upstream 314908 34466395 ~ 34466513 (-)
XLOC_004249 NA non-coding upstream 399360 34550847 ~ 34577106 (-)

Expression


Co-expression Network