G2342114



Basic Information


Item Value
gene id G2342114
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493668.1
NCBI id JAAXML020000291.1
chromosome length 1079841
location 427376 ~ 427587 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2682348
ctggtaagaagaggggcagggaggtacgccttatgattaacgagacgtggtgtgaccataacaacatacaggaactcaagtcattctgttcacctgacttagatttcgtcacaatcaaatgtcgaccacattatctaccaagagaattctcttcgattataatcacagccgtatatatttgtccccaagcagacacatcgatggccctgaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2682348 True 212 lncRNA 0.44 1 427376 427587

Neighbor


gene id symbol gene type direction distance location
fam117ba LOC106575892 coding upstream 90658 300525 ~ 336718 (+)
LOC110524928 bmpr2 coding upstream 146672 226700 ~ 280704 (+)
LOC110512950 LOC106575054 coding upstream 388672 31499 ~ 39258 (+)
LOC118947559 LOC106575045 coding downstream 78555 506142 ~ 537996 (+)
LOC118947561 LOC106593246 coding downstream 121928 549515 ~ 550735 (+)
LOC118947575 NA coding downstream 123169 550756 ~ 550934 (+)
LOC118947558 nol5 coding downstream 124273 551860 ~ 570372 (+)
LOC118947569 NA coding downstream 129341 556928 ~ 557005 (+)
G2342111 NA non-coding upstream 9215 417922 ~ 418161 (+)
G2342110 NA non-coding upstream 10330 416805 ~ 417046 (+)
G2342107 NA non-coding upstream 17317 409801 ~ 410059 (+)
G2342106 NA non-coding upstream 20759 404278 ~ 406617 (+)
G2342083 NA non-coding upstream 85552 337861 ~ 341824 (+)
G2342137 NA non-coding downstream 6779 434366 ~ 434619 (+)
G2342139 NA non-coding downstream 11989 439576 ~ 440541 (+)
G2342140 NA non-coding downstream 13701 441288 ~ 442711 (+)
G2342146 NA non-coding downstream 31172 458759 ~ 460410 (+)
G2342148 LOC106575933 non-coding downstream 39958 467545 ~ 759618 (+)
G2342085 NA other upstream 119269 307014 ~ 308107 (+)
G2341964 NA other upstream 358195 63041 ~ 69181 (+)
G2342223 NA other downstream 354683 782270 ~ 784678 (+)
wdr12 LOC106575933 other downstream 386653 814203 ~ 846223 (+)
G2342247 NA other downstream 504048 931635 ~ 933855 (+)
G2342447 NA other downstream 533219 960806 ~ 963092 (+)

Expression


G2342114 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2342114 Expression in each Bioproject

Bar chart with 15 bars.
G2342114 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network