G2343189


Basic Information

Item Value
gene id G2343189
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493670.1
NCBI id JAAXML020000887.1
chromosome length 928286
location 292132 ~ 406295 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2683957
atatggtctattggtttctctctaaagctaactttcatcaaggttgtatatggtctattggtttctctctaaagctaactttcatcaaggttgtatatggtctattggtttctctctaaagctaactttcatcaaggtttcatatggtctattggttcctctctaaagctaactttcatcaaggtttcatatggtctattgg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2683957 True 202 lncRNA 0.35 2 292132 406295
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118947626 LOC106595264 coding upstream 17368 265758 ~ 274764 (+)
LOC118947627 LOC106595305 coding upstream 33734 245205 ~ 258398 (+)
LOC110514247 LOC106595205 coding upstream 50825 225395 ~ 241307 (+)
LOC110519500 LOC106564015 coding upstream 72808 211203 ~ 219324 (+)
LOC110512362 LOC106608471 coding upstream 98952 191901 ~ 193180 (+)
LOC110519809 LOC106592670 coding downstream 130041 536336 ~ 543665 (+)
LOC118947614 NA coding downstream 146553 552848 ~ 556284 (+)
LOC118947628 LOC106591075 coding downstream 443635 849930 ~ 858980 (+)
LOC110515697 LOC106591074 coding downstream 458859 865154 ~ 874888 (+)
G2343181 NA non-coding upstream 12240 279248 ~ 279892 (+)
G2343115 NA non-coding upstream 98158 113326 ~ 193974 (+)
G2343107 NA non-coding upstream 147990 108742 ~ 144142 (+)
G2343111 NA non-coding upstream 172134 112964 ~ 119998 (+)
G2343236 NA non-coding downstream 10856 417151 ~ 488426 (+)
G2343114 NA non-coding downstream 74013 480308 ~ 500314 (+)
G2343301 NA non-coding downstream 155995 562290 ~ 644694 (+)
G2343305 NA non-coding downstream 169307 575602 ~ 597126 (+)
G2343201 NA other downstream 195271 601566 ~ 650407 (+)

Expression

G2343189 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2343189 Expression in each Bioproject

Bar chart with 5 bars.
G2343189 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network