G2343236


Basic Information

Item Value
gene id G2343236
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493670.1
NCBI id JAAXML020000887.1
chromosome length 928286
location 417151 ~ 488426 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2684024
cctcctttaagactccataatgtttcatcattaggtgctacagtcctcctttaagactccataatgtttcatcattagatgctacagtcctcctttaagactccataatgtttcatcattagatgctacagtcctcctttaagactccataatgtttcatcattagatgttacagtcctcctttaagtctccatcatgtttagaatgtgtctggaagcgctactctatctattct

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2684024 True 235 lncRNA 0.37 2 417151 488426
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118947626 LOC106595264 coding upstream 142387 265758 ~ 274764 (+)
LOC118947627 LOC106595305 coding upstream 158753 245205 ~ 258398 (+)
LOC110514247 LOC106595205 coding upstream 175844 225395 ~ 241307 (+)
LOC110519500 LOC106564015 coding upstream 197827 211203 ~ 219324 (+)
LOC110512362 LOC106608471 coding upstream 223971 191901 ~ 193180 (+)
LOC110519809 LOC106592670 coding downstream 47910 536336 ~ 543665 (+)
LOC118947614 NA coding downstream 64422 552848 ~ 556284 (+)
LOC118947628 LOC106591075 coding downstream 361504 849930 ~ 858980 (+)
LOC110515697 LOC106591074 coding downstream 376728 865154 ~ 874888 (+)
G2343230 NA non-coding upstream 1399 400201 ~ 415752 (+)
G2343189 NA non-coding upstream 10856 292132 ~ 406295 (+)
G2343222 NA non-coding upstream 22849 379581 ~ 394302 (+)
G2343210 NA non-coding upstream 32365 367205 ~ 384786 (+)
G2343211 NA non-coding upstream 43978 323857 ~ 373173 (+)
G2343301 NA non-coding downstream 73864 562290 ~ 644694 (+)
G2343305 NA non-coding downstream 87176 575602 ~ 597126 (+)
G2343314 NA non-coding downstream 110871 599297 ~ 618197 (+)
G2343325 NA non-coding downstream 163480 651906 ~ 691766 (+)
G2343201 NA other downstream 113140 601566 ~ 650407 (+)

Expression

G2343236 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

G2343236 Expression in each Bioproject

Bar chart with 17 bars.
G2343236 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network