G2344530



Basic Information


Item Value
gene id G2344530
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493672.1
NCBI id JAAXML020000394.1
chromosome length 888553
location 213747 ~ 214013 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2685828
gtcatgtgataggttagagttagatagactaggtcatgtgataggttagagttagatagactaggtcatgtgataggttagagttagataggctaggtcatgtgatatgttagagttagatagactaggtcatgtgataggttagagttagatagactaggtcatgtgataggttagagttagatagactaggtcatgtgataggttagagttagataggctaggtcatgtgataggttagagttagatagactaggtaatgtgata

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2685828 True 267 lncRNA 0.37 1 213747 214013
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110534599 kiaa0368 coding downstream 172301 170 ~ 41446 (-)
LOC110517917 LOC106595072 coding upstream 480779 694792 ~ 819312 (-)
G2344527 NA non-coding downstream 760 206889 ~ 212987 (-)
G2344524 NA non-coding downstream 13540 200006 ~ 200207 (-)
G2344523 NA non-coding downstream 14930 198543 ~ 198817 (-)
G2344518 NA non-coding downstream 31015 182421 ~ 182732 (-)
G2344516 NA non-coding downstream 32191 181108 ~ 181556 (-)
G2344531 NA non-coding upstream 611 214624 ~ 214854 (-)
G2344533 NA non-coding upstream 7842 221855 ~ 222118 (-)
G2344535 NA non-coding upstream 15428 229441 ~ 229803 (-)
G2344536 NA non-coding upstream 19260 233273 ~ 233483 (-)
G2344537 NA non-coding upstream 20004 234017 ~ 234492 (-)
G2344505 NA other downstream 47638 165388 ~ 166109 (-)
G2344464 LOC106593555 other downstream 144204 67053 ~ 69543 (-)

Expression


G2344530 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2344530 Expression in each Bioproject

Bar chart with 11 bars.
G2344530 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network