G2344903



Basic Information


Item Value
gene id G2344903
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493672.1
NCBI id JAAXML020000394.1
chromosome length 888553
location 824776 ~ 825134 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2686362
CTTTAATGGTATAGGTTAGAGTTGAACATCTCCTGACTGTCTGAGCATATATGGGTTAATTTGTTCCTAGACACTGACCTAGGAACAGGTTTATGTCCTTCCCCTTTAATGGTATAGGTTAGAGTTGAACATCTCCTGACTGTCTGGGTTCATTTGTTCCTAGACACTGACCTAGGAACAGGTTTATGCCCTCCCCCTTTAATGGTATAGGTTAGAGTTGAACATCTCCTGACTGTCTGGATTCATTTGTTCCTAGACACTGACCTAGGAACAGGTGTATGCCCTCCCCCTTTAATGGTATAGGTTAGAGTTGAACATGTCCTGACTGTCTGGGTTCATTTGTTCCTAGACACTGACCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2686362 True 359 lncRNA 0.43 1 824776 825134
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110517917 LOC106595072 coding downstream 5464 694792 ~ 819312 (-)
LOC110519864 LOC103353169 coding downstream 421615 123398 ~ 403161 (-)
LOC110534599 kiaa0368 coding downstream 783330 170 ~ 41446 (-)
G2344899 NA non-coding downstream 3124 820923 ~ 821652 (-)
G2344884 NA non-coding downstream 34846 788933 ~ 789930 (-)
G2344875 NA non-coding downstream 69964 754248 ~ 754812 (-)
G2344873 NA non-coding downstream 72851 751019 ~ 751925 (-)
G2344862 NA non-coding downstream 126832 697475 ~ 697944 (-)
G2344916 NA non-coding upstream 13763 838897 ~ 839104 (-)
G2344920 NA non-coding upstream 17874 843008 ~ 843241 (-)
G2344922 NA non-coding upstream 19000 844134 ~ 844339 (-)
G2344925 NA non-coding upstream 19969 845103 ~ 845335 (-)
G2344933 NA non-coding upstream 33769 858903 ~ 859202 (-)
G2344505 NA other downstream 658667 165388 ~ 166109 (-)
G2344464 LOC106593555 other downstream 755233 67053 ~ 69543 (-)

Expression


G2344903 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2344903 Expression in each Bioproject

Bar chart with 8 bars.
G2344903 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network