G2345690



Basic Information


Item Value
gene id G2345690
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493674.1
NCBI id JAAXML020000349.1
chromosome length 871358
location 214781 ~ 215210 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2687499
ctagagcctgtaggacctgccttgttgatagtgttgttaagaaggtagaaactagggcctgtaggacctgccttgttgatagtgttgttaagaaggtagaaactagggcctgtaggacctgccttgttggtagtgttgttaagaaggtagaaactagggcctgtaggacctgccttgttggtagtgttgttaagaaggtagaaactagggcctgtaggacctgccttgttgatagtgctgttaagaaggtagaaactagggcctgtaggacctgccttgttgatagtgttgttaagaaggtagaaacgagggcctgtaggacctgcct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2687499 True 328 lncRNA 0.47 2 214781 215210

Neighbor


gene id symbol gene type direction distance location
LOC110519241 LOC106593460 coding upstream 167090 10543 ~ 48354 (+)
LOC118947675 NA coding downstream 74539 289749 ~ 291422 (+)
LOC118936629 LOC106593446 coding downstream 76225 291432 ~ 310387 (+)
LOC118936628 LOC106595881 coding downstream 249299 464509 ~ 500660 (+)
LOC110513588 dmtf1 coding downstream 339698 554908 ~ 580828 (+)
LOC110510957 LOC106593040 coding downstream 388333 603543 ~ 631185 (+)
G2345684 NA non-coding upstream 5568 208893 ~ 209213 (+)
G2345679 NA non-coding upstream 16385 198171 ~ 198396 (+)
G2345678 NA non-coding upstream 16815 197336 ~ 197966 (+)
G2345675 NA non-coding upstream 28214 185867 ~ 186567 (+)
G2345674 NA non-coding upstream 30402 184180 ~ 184379 (+)
G2345692 NA non-coding downstream 1139 216349 ~ 216613 (+)
G2345703 NA non-coding downstream 15931 231141 ~ 231394 (+)
G2345664 NA non-coding downstream 67267 282477 ~ 282859 (+)
G2345806 NA non-coding downstream 96241 311451 ~ 311822 (+)
G2345642 NA other upstream 115475 98797 ~ 99306 (+)
G2345921 NA other downstream 288704 503914 ~ 504340 (+)
LOC118947678 LOC106591916 other downstream 500042 692798 ~ 830422 (+)

Expression


G2345690 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2345690 Expression in each Bioproject

Bar chart with 18 bars.
G2345690 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network