G2345769


Basic Information

Item Value
gene id G2345769
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493674.1
NCBI id JAAXML020000349.1
chromosome length 871358
location 229768 ~ 230042 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2687592
gtaatgaggagcaaccagatgctgctggtctgtggtgtgtaatgaggagcaaccagacactgctggtctgtggtgtgtaatgaggagcaaccagatgctgctggtctgtggtgtgtaatgaggagcaaccagatgctgctggtctgtggtgagtaatgaggagcaaccagatgctgctggtctgtggtgtgtaatgaggagcaaccagacgctgctggtctgtggtgtgtaatgaggagcaaccagatgctgctggtctgtggtgtgtaatgagg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2687592 True 275 lncRNA 0.53 1 229768 230042

Neighbor

gene id symbol gene type direction distance location
LOC118947677 LOC105015365 coding upstream 88909 317215 ~ 436416 (-)
LOC118947674 cwf19l1 coding upstream 272683 502721 ~ 548123 (-)
LOC118947676 tmem243 coding upstream 354358 584400 ~ 600063 (-)
LOC118947680 meig1 coding upstream 371305 601060 ~ 603458 (-)
LOC110510905 LOC100380711 coding upstream 400254 630296 ~ 654400 (-)
G2345763 NA non-coding downstream 10672 218796 ~ 219096 (-)
G2345761 NA non-coding downstream 12662 216722 ~ 217106 (-)
G2345760 NA non-coding downstream 13292 216242 ~ 216476 (-)
G2345755 NA non-coding downstream 21945 207547 ~ 207823 (-)
G2345754 NA non-coding downstream 22580 206912 ~ 207188 (-)
G2345772 NA non-coding upstream 8804 238846 ~ 239078 (-)
G2345790 NA non-coding upstream 49762 279804 ~ 282971 (-)
G2345801 NA non-coding upstream 63599 293641 ~ 295623 (-)
G2345800 NA non-coding upstream 67370 297412 ~ 303564 (-)
G2345804 NA non-coding upstream 74159 304201 ~ 308358 (-)
G2345887 NA other upstream 207058 437100 ~ 444457 (-)
G2346165 LOC106591916 other upstream 562109 792151 ~ 792776 (-)
G2346172 NA other upstream 581984 812026 ~ 812450 (-)

Expression

G2345769 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2345769 Expression in each Bioproject

Bar chart with 20 bars.
G2345769 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network