G2346181



Basic Information


Item Value
gene id G2346181
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493674.1
NCBI id JAAXML020000349.1
chromosome length 871358
location 834587 ~ 834805 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2688217
gtccgatataacgctgaccagaattaacaaaagaaggtatttggacataaataacggacattttcgaacaaaacaaacatttattgtggacctgggattcctggagtgctttctgatgtagatcatcaaaggtaagggaatatttatcatgtaatttcttgtttatgttgacgccatctttgtggctgtggtgtttttaaattgagcgccgtctcagat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2688217 True 219 lncRNA 0.37 1 834587 834805

Neighbor


gene id symbol gene type direction distance location
LOC110510905 LOC100380711 coding downstream 180187 630296 ~ 654400 (-)
LOC118947681 NA coding downstream 187944 645991 ~ 646643 (-)
LOC118947680 meig1 coding downstream 231699 601060 ~ 603458 (-)
LOC118947676 tmem243 coding downstream 234524 584400 ~ 600063 (-)
LOC118947674 cwf19l1 coding downstream 286464 502721 ~ 548123 (-)
G2346179 LOC104946971 non-coding downstream 3832 826036 ~ 830755 (-)
G2346176 NA non-coding downstream 12010 818878 ~ 822577 (-)
G2346168 NA non-coding downstream 23818 796323 ~ 810769 (-)
G2346164 NA non-coding downstream 44911 788379 ~ 789676 (-)
G2346160 NA non-coding downstream 56149 778165 ~ 778438 (-)
G2346184 NA non-coding upstream 3449 838254 ~ 838465 (-)
G2346188 NA non-coding upstream 5375 840180 ~ 841378 (-)
G2346172 NA other downstream 22137 812026 ~ 812450 (-)
G2346165 LOC106591916 other downstream 41811 792151 ~ 792776 (-)
G2345887 NA other downstream 390130 437100 ~ 444457 (-)
LOC118947677 LOC105015365 other downstream 417901 317215 ~ 436416 (-)

Expression


G2346181 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2346181 Expression in each Bioproject

Bar chart with 18 bars.
G2346181 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network