G2347121


Basic Information

Item Value
gene id G2347121
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493676.1
NCBI id JAAXML020000344.1
chromosome length 856417
location 447685 ~ 448020 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2689460
ggacccaggtcatcaataggatggtggtactcaccagatcagactgtctggacccaggtcatcaataggatggtggtacaacaccagatcagactgtctggacccaggtcatcaataggatggtggtacaacaccagatcagactgtctggacccaggtcatcaataggatggtggtactcaccagatcagactgtctggacccaggtcatcaataggatggtggtactcaccagatcagactgtctggacccaggtcatcaataggatggtggtactcaccagatcagactgtctggacccagatcatcaataggatggtgggactcaccagatc

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2689460 True 336 lncRNA 0.51 1 447685 448020
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118947711 NA coding downstream 15542 429659 ~ 432143 (-)
LOC118947716 NA coding downstream 21414 419741 ~ 426271 (-)
LOC110511058 NA coding downstream 37935 407674 ~ 409750 (-)
LOC110511057 NA coding downstream 55363 384795 ~ 392322 (-)
LOC110515504 LOC106594978 coding downstream 76466 347816 ~ 371219 (-)
LOC118947717 LOC106594941 coding upstream 5099 453119 ~ 457555 (-)
LOC118947704 NA coding upstream 13166 459740 ~ 461968 (-)
LOC110517267 LOC106594732 coding upstream 14253 462273 ~ 844971 (-)
LOC118947705 NA coding upstream 269216 717236 ~ 718394 (-)
LOC118947712 LOC106594764 non-coding downstream 108901 330695 ~ 339136 (-)
G2346953 LOC106603761 non-coding downstream 148239 298871 ~ 299446 (-)
G2347053 NA non-coding downstream 155470 271517 ~ 292215 (-)
G2347257 NA non-coding upstream 35136 483156 ~ 483372 (-)
G2347266 NA non-coding upstream 74701 522721 ~ 523424 (-)
G2347279 NA non-coding upstream 99701 547721 ~ 548213 (-)
G2347286 NA non-coding upstream 123705 571725 ~ 572626 (-)
LOC118947714 LOC106564023 other downstream 165493 105059 ~ 282192 (-)
G2347341 NA other upstream 308169 756189 ~ 765433 (-)

Expression

G2347121 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2347121 Expression in each Bioproject

Bar chart with 9 bars.
G2347121 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network