G2347279



Basic Information


Item Value
gene id G2347279
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493676.1
NCBI id JAAXML020000344.1
chromosome length 856417
location 547721 ~ 548213 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2689702
GAATTTAATTTACTCTGATTTTCTCCCCATTATAACTGTGTAGGGGGGTAGATAACAGTGGTTTCCTGTTAGAGGAATTTAATTTACTCTGATTTTCTCCCCATTATAACTGTGTAGGGGGGTAGATAACAGTGGTTTCCTGTTAGAGGAATTTAATTTACTCTGAATTTCTCCCCATTATAACTGTGTAGGGGGGGGGTAGATAACAGTGGTTTCCTGTTAGAGGAATTTAATTTACTCTGATTTTCTCCCCATTATAACTGTGTAGGGGGGGTAGATAACAGTGGTTTCCTGTTAGAGGAATTTAATTTACTCTGATTTTCTCCCCATTATAACTGTGTAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2689702 True 344 lncRNA 0.38 2 547721 548213
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118947704 NA coding downstream 85753 459740 ~ 461968 (-)
LOC118947717 LOC106594941 coding downstream 90166 453119 ~ 457555 (-)
LOC118947711 NA coding downstream 115578 429659 ~ 432143 (-)
LOC118947716 NA coding downstream 121450 419741 ~ 426271 (-)
LOC110511058 NA coding downstream 137971 407674 ~ 409750 (-)
LOC118947705 NA coding upstream 169023 717236 ~ 718394 (-)
G2347266 NA non-coding downstream 24297 522721 ~ 523424 (-)
G2347257 NA non-coding downstream 64349 483156 ~ 483372 (-)
G2347121 NA non-coding downstream 99701 447685 ~ 448020 (-)
LOC110511057 NA non-coding downstream 155419 384795 ~ 392322 (-)
G2347286 NA non-coding upstream 23512 571725 ~ 572626 (-)
G2347273 NA non-coding upstream 38856 587069 ~ 590516 (-)
G2347311 NA non-coding upstream 110249 658462 ~ 664432 (-)
LOC118947714 LOC106564023 other downstream 265529 105059 ~ 282192 (-)
LOC110517267 LOC106594732 other upstream 23011 462273 ~ 844971 (-)
G2347341 NA other upstream 207976 756189 ~ 765433 (-)

Expression


G2347279 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2347279 Expression in each Bioproject

Bar chart with 4 bars.
G2347279 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network