G2349714


Basic Information

Item Value
gene id G2349714
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493683.1
NCBI id JAAXML020000310.1
chromosome length 673672
location 484446 ~ 484771 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2693201
ACATTATTCAGACTGAGGATGAAATATCACCAACACATTCAGACTGAGGGTGTAAATATCACCAACACATTCAGACTGAGGGTGGAAATATCACCAACACATTCAGACCGAGGATGTAAATATCACCAACACATTCAGACTGAGGATGTAAATATCACCAACACATTCAGACTGAGGATGTAAATATCACCAACACATTCAGACTGAGGATGTAAATATCACCAACACATTCAGACTGAGGGTGGAAATATCACCAACACATTCAGACTGAGGATGTAAATATCACCAACACATTCAGAC

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2693201 True 300 lncRNA 0.39 2 484446 484771
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110513598 LOC106591942 coding downstream 11366 375895 ~ 473080 (-)
LOC118947863 NA coding downstream 141686 341520 ~ 342760 (-)
LOC118947858 NA coding downstream 194927 287742 ~ 289519 (-)
LOC118947865 NA coding downstream 212493 269911 ~ 271953 (-)
LOC110516074 smc2 coding downstream 218220 220817 ~ 266226 (-)
LOC118947866 NA coding upstream 124820 609591 ~ 609899 (-)
LOC118947877 NA coding upstream 126745 611516 ~ 611679 (-)
LOC118947895 NA coding upstream 128636 613407 ~ 613562 (-)
LOC118947896 NA coding upstream 130519 615290 ~ 615445 (-)
LOC118947897 NA coding upstream 132402 617173 ~ 617328 (-)
G2349702 NA non-coding downstream 4254 479750 ~ 480192 (-)
G2349690 NA non-coding downstream 45552 435331 ~ 438894 (-)
G2349686 NA non-coding downstream 56131 427937 ~ 428315 (-)
G2349682 NA non-coding downstream 70670 410043 ~ 413776 (-)
G2349639 NA non-coding downstream 109963 372833 ~ 374483 (-)
G2349715 NA non-coding upstream 262 485033 ~ 485404 (-)
G2349708 NA non-coding upstream 33862 518633 ~ 520063 (-)
G2349706 NA non-coding upstream 40316 525087 ~ 525572 (-)
G2349747 LOC106592313 non-coding upstream 86471 571242 ~ 599946 (-)
G2349746 LOC106592594 non-coding upstream 90329 575100 ~ 606254 (-)
G2349745 LOC106594467 other upstream 112652 597423 ~ 598977 (-)

Expression

G2349714 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2349714 Expression in each Bioproject

Bar chart with 10 bars.
G2349714 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network