G2351425



Basic Information


Item Value
gene id G2351425
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493687.1
NCBI id JAAXML020000410.1
chromosome length 614079
location 490778 ~ 491307 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2695755
ctcccagtatggtggtgtggtgtgggttaacactgtggactctcccagtatggtggtgtggtgtgggttaacactgtggactctcccagtacggtggtgtgggttaacactgtggactctcccagtatggtggtgtggtgtgggttaacactgtggactcttctagtgtggtggtgtggtgtgggttaacactgtggactctcccagtgtggtggtgtgggttaacactgtggactctcccagtatggtggtgtggtgtgggttaacactgtggactctcccagtgtggtggtgtgggttaacactgtggactctcccagtatggtggtgtggtgtgggttaacactgtggactctcccagtatggtggtgtggtgtgggttaacactgtggactctcccagtatggtggtgtggtgtgggttaacactgtggactctcccagtgtggtggtgtggtgtgggttaacactgtggactctcccagtgtggtggtgtgggttaacactgtggactctcccagtgtggtggtg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2695755 True 530 lncRNA 0.55 1 490778 491307
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110514251 NA coding downstream 77620 406697 ~ 413158 (-)
trnak-cuu-378 NA coding downstream 103327 387379 ~ 387451 (-)
trnak-cuu-377 NA coding downstream 104322 386384 ~ 386456 (-)
trnar-ccu-56 NA coding downstream 105316 385390 ~ 385462 (-)
trnak-cuu-376 NA coding downstream 105805 384901 ~ 384973 (-)
G2351421 NA non-coding downstream 14760 475767 ~ 476018 (-)
G2351420 NA non-coding downstream 15118 474864 ~ 475660 (-)
G2351418 NA non-coding downstream 24254 466286 ~ 466524 (-)
G2351416 NA non-coding downstream 26959 463598 ~ 463819 (-)
G2351413 NA non-coding downstream 27481 462953 ~ 463297 (-)
G2351390 NA non-coding upstream 11715 503022 ~ 506387 (-)
G2351431 NA non-coding upstream 24518 515825 ~ 516381 (-)
G2351434 NA non-coding upstream 26671 517978 ~ 518197 (-)
G2351437 NA non-coding upstream 30390 521697 ~ 524067 (-)
G2351439 NA non-coding upstream 36985 528292 ~ 528581 (-)
G2351211 NA other downstream 328488 161763 ~ 162290 (-)

Expression


G2351425 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2351425 Expression in each Bioproject

Bar chart with 14 bars.
G2351425 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network