G2353714



Basic Information


Item Value
gene id G2353714
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493694.1
NCBI id JAAXML020000446.1
chromosome length 566240
location 66195 ~ 67817 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2698650
CTCTAGTGGTAGGTTTATGGTAGTGTCTGTTCATCATTAAACCCTCTAGTGGTAGGTTTATGGTAGTGTCTGTCATTAAACCCTCTAGTGGTAGGTTTATGGTAGTGTCTGTTCATCATTAAACCCTCTAGTGGTAGGTTTATGGTAGTGTCTGTTCATCATTAAACCCTCTAGTGGTAGGTTTATGGTAGTGTCTGTTCATCATTAAACCCTCTAGTGGTAGGTTTATGGTAGTGTCCATCATTAAACCCTCTAGTGGTAGGTTTATGGTAGTGTTCATCATTAAACCCTCTAGTGGTAGGTTTATGGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2698650 True 310 lncRNA 0.40 2 66195 67817
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110513695 NA coding upstream 10526 78343 ~ 83632 (-)
ldlrad4b LOC106591938 coding upstream 120786 188603 ~ 228256 (-)
LOC110511365 LOC106594566 coding upstream 229718 297535 ~ 411847 (-)
LOC118948224 NA coding upstream 363480 430891 ~ 436046 (-)
G2353711 NA non-coding downstream 994 64958 ~ 65201 (-)
G2353707 NA non-coding downstream 8420 57535 ~ 57775 (-)
G2353704 NA non-coding downstream 9838 56129 ~ 56357 (-)
G2353700 NA non-coding downstream 11103 53046 ~ 55092 (-)
G2353697 NA non-coding downstream 15165 50805 ~ 51030 (-)
G2353805 NA non-coding upstream 40655 108472 ~ 109035 (-)
G2353816 NA non-coding upstream 54334 122151 ~ 127236 (-)
G2353828 NA non-coding upstream 75172 142989 ~ 143206 (-)
G2353840 NA non-coding upstream 131707 199524 ~ 200303 (-)
G2354057 NA other upstream 467463 535280 ~ 536850 (-)

Expression


G2353714 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2353714 Expression in each Bioproject

Bar chart with 4 bars.
G2353714 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network