G2358347



Basic Information


Item Value
gene id G2358347
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493710.1
NCBI id JAAXML020000403.1
chromosome length 357920
location 102086 ~ 104210 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2705016
actctctctctctactctctctctctactactctctctctctctactctctctctctctactactctctctctattactctctctctctactctctctctctctactctctctctctctactactctctctctattactctctctctctactctctctctctctactctctctctctctattactctctctctattactctctctctactactctctctctattactctctctctctctattactctctctctctactactctctctctctattactctctctctctattactctctctctctactactctctctctactactctctctctactactctctctctctctactactctctctctctactactctctctctctactactctctctctctattactctctctctctactactctctctctctactctctctctctattactctctctctctattactctctctctctattactctctctctactactctctctctactactctctctcta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2705016 True 517 lncRNA 0.42 2 102086 104210

Neighbor


gene id symbol gene type direction distance location
LOC118948726 NA coding upstream 178941 280853 ~ 284472 (-)
LOC118948728 LOC106570794 coding upstream 182685 286895 ~ 342389 (-)
G2358345 NA non-coding downstream 2553 97133 ~ 99533 (-)
G2358326 NA non-coding downstream 12776 54387 ~ 89310 (-)
G2358338 NA non-coding downstream 25139 76601 ~ 76947 (-)
G2358323 NA non-coding downstream 44389 44948 ~ 57697 (-)
G2358262 NA non-coding downstream 69684 30940 ~ 32402 (-)
G2358356 NA non-coding upstream 16900 121110 ~ 122720 (-)
G2358361 NA non-coding upstream 41637 145847 ~ 147742 (-)
G2358378 NA non-coding upstream 97709 201919 ~ 202292 (-)
G2358381 NA non-coding upstream 101832 206042 ~ 207564 (-)
G2358389 NA non-coding upstream 114079 218289 ~ 218514 (-)

Expression


G2358347 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2358347 Expression in each Bioproject

Bar chart with 7 bars.
G2358347 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network