G2364337



Basic Information


Item Value
gene id G2364337
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493751.1
NCBI id JAAXML020000463.1
chromosome length 211368
location 120083 ~ 120377 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2713302
attctgccaggctggcataggctactttgcagttaacatttgattgagaaggtttttgtgggaagcctttccttctctacctaccacaagaaggttatcattagcctcatcgctaacggctacacaaagtgtagacatgcgcgcgctctgcacgcatgcgcacggaaactgggcagtcctgtgcagtttctgaaagttgcgtggaaatacgaatcactgatgcattttgttcatgtcttatgattcacttgggcaaatgaatggattttctaacaagttgaagggaatgatttga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2713302 True 295 lncRNA 0.44 1 120083 120377
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118949986 NA coding downstream 265 119700 ~ 119818 (-)
LOC118950010 NA coding downstream 1549 118416 ~ 118534 (-)
LOC118950009 NA coding downstream 2853 117112 ~ 117230 (-)
LOC118950008 NA coding downstream 4142 115823 ~ 115941 (-)
LOC118950007 NA coding downstream 5443 114522 ~ 114640 (-)
LOC118950012 NA coding upstream 575 120952 ~ 121070 (-)
LOC118949987 NA coding upstream 1857 122234 ~ 122352 (-)
LOC118950013 NA coding upstream 3107 123484 ~ 123602 (-)
LOC118950014 NA coding upstream 4409 124786 ~ 124904 (-)
LOC118950015 NA coding upstream 5691 126068 ~ 126186 (-)
G2364329 NA non-coding downstream 69627 35147 ~ 50456 (-)
G2364338 NA non-coding upstream 17468 137845 ~ 138183 (-)
G2364363 NA non-coding upstream 41972 162349 ~ 192363 (-)
G2364367 NA non-coding upstream 63712 184089 ~ 187194 (-)

Expression


G2364337 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2364337 Expression in each Bioproject

Bar chart with 5 bars.
G2364337 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network