LOC118953769


Basic Information

Item Value
gene id LOC118953769
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493822.1
NCBI id JAAXML020000375.1
chromosome length 127320
location 44475 ~ 44593 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XR_005044027.1
gcttacggccacaccggcatgagtacacctgatctcgtccgatctcggaagctaagcagggtcgggcctggttagtacttggatgggagaccgcctgggaataccaggtgctgtaagct

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_005044027.1 True 119 mRNA 0.58 1 44475 44593

Neighbor

gene id symbol gene type direction distance location
LOC118953852 NA coding upstream 178 44179 ~ 44297 (+)
LOC118953648 NA coding upstream 557 43800 ~ 43918 (+)
LOC118953845 NA coding upstream 936 43421 ~ 43539 (+)
LOC118953798 NA coding upstream 1232 43125 ~ 43243 (+)
LOC118953770 NA coding downstream 178 44771 ~ 44889 (+)
LOC118953649 NA coding downstream 557 45150 ~ 45268 (+)
LOC118953771 NA coding downstream 853 45446 ~ 45564 (+)
LOC118953650 NA coding downstream 1232 45825 ~ 45943 (+)
LOC118953938 NA coding downstream 1528 46121 ~ 46239 (+)
G2368863 NA non-coding upstream 3611 40570 ~ 40864 (+)
G2368862 NA non-coding upstream 5766 38208 ~ 38709 (+)
G2368861 NA non-coding upstream 7267 36751 ~ 37208 (+)
G2368860 NA non-coding upstream 12289 31868 ~ 32186 (+)
G2368859 NA non-coding upstream 17794 26182 ~ 26681 (+)

Expression

LOC118953769 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

LOC118953769 Expression in each Bioproject

Bar chart with 1 bar.
LOC118953769 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network