XLOC_004372 (FO834831.1)


Basic Information

Item Value
gene id XLOC_004372
gene name FO834831.1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 43228412 ~ 43230364 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00008287
agcaggcagacgcagcttctgcaatggtcgacattaactgctcccagcagcggatctgattaacacgataccaaagtgattttgttacctgtggatcttcaaactttacatccagagttgtgaggaatcagaggtgcatgcggctgcccacgggaaaaatttgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttgagatatattagagactctttgtgggactggacattatgcatccaaaatcttcatcaaaatatgcaaatctcctcactgagttgccttggatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtacgtgtagccacattaatggcctattttgtagtcactattaaaaggaacatcgattgatattgaa

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0008152 metabolic process biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0006396 RNA processing biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:0006412 translation biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0044238 primary metabolic process biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0071704 organic substance metabolic process biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0043484 regulation of RNA splicing biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0031167 rRNA methylation biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0008380 RNA splicing biological_process
GO:1990904 ribonucleoprotein complex cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0005634 nucleus cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0005730 nucleolus cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0140102 catalytic activity, acting on a rRNA molecular_function
GO:0008649 rRNA methyltransferase activity molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000105456

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00008287 True 503 lncRNA 0.41 3 43228412 43230364

Neighbor

gene id symbol gene type direction distance location
XLOC_004370 sptbn1 coding downstream 2157 43135198 ~ 43226255 (-)
XLOC_004371 NA coding downstream 24205 43201535 ~ 43204207 (-)
XLOC_004369 acyp2 coding downstream 123937 43102421 ~ 43104475 (-)
XLOC_004368 NA coding downstream 165426 43061882 ~ 43062986 (-)
XLOC_004367 EML6 coding downstream 226150 42929547 ~ 43002262 (-)
XLOC_004373 NA coding upstream 225105 43455469 ~ 43457258 (-)
XLOC_004374 NA coding upstream 231031 43461395 ~ 43466520 (-)
XLOC_004375 tmem63bb coding upstream 239812 43470176 ~ 43473824 (-)
XLOC_004376 NA coding upstream 483346 43713710 ~ 43716304 (-)
XLOC_004377 INHBB coding upstream 717727 43948091 ~ 43948885 (-)
XLOC_004063 CR854846.1 misc downstream 27100734 16127382 ~ 16127678 (-)
XLOC_004019 CR450764.8 misc downstream 30536721 12691395 ~ 12691691 (-)
XLOC_004015 CR450764.4 misc downstream 30606645 12621518 ~ 12621767 (-)
XLOC_004013 CABZ01022569.1 misc downstream 30637116 12590999 ~ 12591296 (-)
XLOC_004008 BX000700.19 misc downstream 30715150 12512966 ~ 12513262 (-)
XLOC_004365 NA non-coding downstream 410708 42809514 ~ 42817704 (-)
XLOC_004363 NA non-coding downstream 483232 42742534 ~ 42745180 (-)
XLOC_004356 NA non-coding downstream 1075839 42151444 ~ 42152573 (-)
XLOC_004380 FO704721.3 non-coding upstream 869975 44100339 ~ 44120354 (-)
XLOC_004381 FO704721.2 non-coding upstream 892963 44123327 ~ 44123458 (-)

Expression


Co-expression Network