LOC118962536


Basic Information

Item Value
gene id LOC118962536
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023494225.1
NCBI id JAAXML020000895.1
chromosome length 50842
location 24532 ~ 24650 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XR_005049875.1
gcttacggccacaccggcctgagtacgcctgatctcgtccgatctcggaagctaagcggggtcgggcctggttagtacttggatgggagaccgcctgggaataccaggtgctgtaagct

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_005049875.1 True 119 mRNA 0.61 1 24532 24650

Neighbor

gene id symbol gene type direction distance location
LOC118962596 NA coding upstream 261 24153 ~ 24271 (+)
LOC118962573 NA coding upstream 557 23857 ~ 23975 (+)
LOC118962585 NA coding upstream 936 23478 ~ 23596 (+)
LOC118962535 NA coding upstream 1232 23182 ~ 23300 (+)
LOC118962503 NA coding upstream 1611 22803 ~ 22921 (+)
LOC118962607 NA coding downstream 178 24828 ~ 24946 (+)
LOC118962574 NA coding downstream 557 25207 ~ 25325 (+)
LOC118962618 NA coding downstream 853 25503 ~ 25621 (+)
LOC118962580 NA coding downstream 1232 25882 ~ 26000 (+)
LOC118962509 NA coding downstream 1528 26178 ~ 26296 (+)

Expression

LOC118962536 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

LOC118962536 Expression in each Bioproject

Bar chart with 12 bars.
LOC118962536 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.

Co-expression Network