G2368028



Basic Information


Item Value
gene id G2368028
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493807.1
NCBI id JAAXML020000542.1
chromosome length 137370
location 29496 ~ 29914 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2718632
ccttctctcagcctatttccgtctctctgtctttctctctgtccaccattccctctctcagaccatttctgtctctctttctctctctttccaccattcccttctctcagcccatttctgtctctctctctctctgtcctccattcccttctctcaacccatttctgtctctctctcattctgtcctccattcccttctctcagcccattctctctctctctctctctctctctctgtccaccattcccttctctcagcccatttctgtctctctctctctctctgtccaccattcccttctctcagaccaattctgtctctctctctctgtccaccattcccttctctcggcccatttctgtctctctctctgtccaccattcccttctctcagcccatttctgtctctctctctctc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2718632 True 419 lncRNA 0.50 1 29496 29914
Loading

Neighbor


gene id symbol gene type direction distance location
G2368027 NA non-coding downstream 1050 28216 ~ 28446 (-)
G2368026 NA non-coding downstream 2941 26047 ~ 26555 (-)
G2368025 NA non-coding downstream 7164 22129 ~ 22332 (-)
G2368065 NA non-coding upstream 37072 66986 ~ 67284 (-)
G2368071 NA non-coding upstream 39220 69134 ~ 69456 (-)
G2368077 NA non-coding upstream 43966 73880 ~ 74104 (-)
G2368078 NA non-coding upstream 45943 75857 ~ 76235 (-)
G2368079 NA non-coding upstream 48312 78226 ~ 78451 (-)
G2368055 NA other upstream 24332 54246 ~ 66353 (-)
G2368082 NA other upstream 52468 82382 ~ 83020 (-)
G2368084 NA other upstream 57898 87812 ~ 88788 (-)
G2368085 NA other upstream 58971 88885 ~ 89303 (-)
G2368087 NA other upstream 60029 89943 ~ 90458 (-)

Expression


G2368028 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2368028 Expression in each Bioproject

Bar chart with 8 bars.
G2368028 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network