G2368077



Basic Information


Item Value
gene id G2368077
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493807.1
NCBI id JAAXML020000542.1
chromosome length 137370
location 73880 ~ 74104 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2718702
gttcagaggtaattaaaatacagtaccctgtgcatgtaaagaatgataaggcaagaaaagattacaaaatgaagctccttatggaaaatcaagagacactttttgctgactattacaaaaatgggaacatcagcaaccttatcttccacacaaaccatcccctggcatggcacagtgctatattagcacactacccctttgttaagagagggggggttaacgagg

Function


NR:

description
PREDICTED: uncharacterized protein LOC107670751 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2718702 True 225 lncRNA 0.40 1 73880 74104

Neighbor


gene id symbol gene type direction distance location
G2368071 NA non-coding downstream 4424 69134 ~ 69456 (-)
G2368065 NA non-coding downstream 6596 66986 ~ 67284 (-)
G2368028 NA non-coding downstream 43966 29496 ~ 29914 (-)
G2368027 NA non-coding downstream 45434 28216 ~ 28446 (-)
G2368026 NA non-coding downstream 47325 26047 ~ 26555 (-)
G2368078 NA non-coding upstream 1753 75857 ~ 76235 (-)
G2368079 NA non-coding upstream 4122 78226 ~ 78451 (-)
G2368086 NA non-coding upstream 15383 89487 ~ 89760 (-)
G2368090 NA non-coding upstream 22402 96506 ~ 96743 (-)
G2368055 NA other downstream 7527 54246 ~ 66353 (-)
G2368082 NA other upstream 8278 82382 ~ 83020 (-)
G2368084 NA other upstream 13708 87812 ~ 88788 (-)
G2368085 NA other upstream 14781 88885 ~ 89303 (-)
G2368087 NA other upstream 15839 89943 ~ 90458 (-)
G2368089 NA other upstream 19817 93921 ~ 94435 (-)

Expression


G2368077 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2368077 Expression in each Bioproject

Bar chart with 16 bars.
G2368077 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network