Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_004478

Basic Information

Item	Value
gene id	XLOC_004478
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007123.7
NCBI id	CM002896.2
chromosome length	49182954
location	4408659 ~ 4450452 (+)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00010876
TCCTGACACACTAAAGTGAAGACCCAGAAATACAGCACATACTCCGAAACCGCCGGGCCATCAGGGGGAGGCGGCTTGAAGTCGACCAATAGCACGTAGGCATACAGAAACAGGAAGAGGAAGTACATCAGAAGGTTGCCGATGAATGAGGTGACAGGAGCGTACCAGAACTGCTTCCAGCGGGAGACCACAAAGCTACTCTTCTTTGGTTTGATGAATGCAGGAGCTCCT

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00010876	True	231	lncRNA	0.52	2	4408659	4450452

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_004477	mmp25b	coding	upstream	130330	4260779 ~ 4278329 (+)
XLOC_004476	mapk7	coding	upstream	169832	4220353 ~ 4238827 (+)
XLOC_004475	itgam	coding	upstream	240909	4160804 ~ 4167750 (+)
XLOC_004474	itgam	coding	upstream	251419	4147714 ~ 4157240 (+)
XLOC_004473	si:dkey-32n7.4	coding	upstream	263626	4114401 ~ 4145033 (+)
XLOC_004480	CABZ01030103.1	coding	downstream	46912	4497364 ~ 4497479 (+)
XLOC_004481	si:dkey-94f20.4	coding	downstream	123244	4573696 ~ 4576816 (+)
XLOC_004482	kansl1a	coding	downstream	235693	4686145 ~ 4725660 (+)
XLOC_004483	NA	coding	downstream	278565	4729017 ~ 4734988 (+)
XLOC_004484	NA	coding	downstream	298119	4748571 ~ 4751852 (+)
XLOC_004472	NA	non-coding	upstream	302249	4103788 ~ 4106410 (+)
XLOC_004471	NA	non-coding	upstream	315086	4092452 ~ 4093573 (+)
XLOC_004469	NA	non-coding	upstream	417236	3986079 ~ 3991423 (+)
XLOC_004456	NA	non-coding	upstream	1636269	2769565 ~ 2772390 (+)
XLOC_004450	NA	non-coding	upstream	1801627	2578020 ~ 2607032 (+)
XLOC_004485	NA	non-coding	downstream	384397	4834849 ~ 4835314 (+)
XLOC_004492	AL929469.5	non-coding	downstream	601110	5051562 ~ 5051697 (+)

Expression

Co-expression Network