XLOC_004541 (kcnh6b)


Basic Information

Item Value
gene id XLOC_004541
gene name kcnh6b
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 9342502 ~ 9347327 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00009036
TGAAGTGGAGGCCAGACTGGATCTCCTGCATAGTCAACTCAACAGGCTGGAGACGAGAATGACTACAGACATCAATGTGATCCTTCAGCTTCTCCAGCGACAGATGGCTCCTGTTCCTCCAGCATACAGCACAGTTTTACCTGACAGACACCCTCCTGACCCCACGGCCCTGTATAGAAACAACACACCGGTGCTTCACAGCCTCTACCCAATCCCAAACATTCAGCTGGACACAAACACTGCCATTCAGAGTTCAGCTCAGCCTGAATCCATGTTCAAGGCAAATTCCCAGGGCTCTCTATCCAGTGGAGTTCACATGGGAGCTGCATCAGACGACTGCGTACCTGAAACTACCAGTGTTTCAACCCCAGCACTTCAGCCCGCTCTGATGGATGCTCCGATGCTCTGCGTGTCCCTCCGCTTTCCTTCATTACCTGGAAAACTAGACACGTCATCACATTCAGAAGACCCTCAGAAACACATGTCTGATCCTGGATTACCGGTCAGCTAA

Function

symbol description
kcnh6b Predicted to enable voltage-gated potassium channel activity. Predicted to be involved in potassium ion transmembrane transport and regulation of membrane potential. Predicted to act upstream of or within potassium ion transport and transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Orthologous to human KCNH6 (potassium voltage-gated channel subfamily H member 6).

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0042391 regulation of membrane potential biological_process
GO:0055085 transmembrane transport biological_process
GO:0006811 ion transport biological_process
GO:0006813 potassium ion transport biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005216 ion channel activity molecular_function
GO:0005249 voltage-gated potassium channel activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-121214-55 Predicted to enable voltage-gated potassium channel activity. Predicted to be involved in potassium ion transmembrane transport and regulation of membrane potential. Predicted to act upstream of or within potassium ion transport and transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Orthologous to human KCNH6 (potassium voltage-gated channel subfamily H member 6).

Ensembl:

ensembl_id ENSDARG00000010296

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00009036 True 511 mRNA 0.51 3 9342502 9347327

Neighbor

gene id symbol gene type direction distance location
XLOC_004540 kcnh6b coding upstream 6271 9320446 ~ 9336231 (+)
XLOC_004539 taco1 coding upstream 26700 9305832 ~ 9315802 (+)
XLOC_004538 pimr46 coding upstream 90451 9250107 ~ 9252051 (+)
XLOC_004537 tubgcp2 coding upstream 124244 9183626 ~ 9218258 (+)
XLOC_004536 NA coding upstream 371470 8968317 ~ 8971032 (+)
XLOC_004542 NA coding downstream 96394 9443721 ~ 9449731 (+)
XLOC_004543 dnajc9 coding downstream 150319 9497646 ~ 9510403 (+)
XLOC_004544 p4ha1a coding downstream 194797 9542124 ~ 9585670 (+)
XLOC_004545 ppp1r9bb coding downstream 355845 9703172 ~ 9777329 (+)
XLOC_004546 NA coding downstream 449710 9797037 ~ 9812486 (+)
XLOC_004533 NA non-coding upstream 785343 8556636 ~ 8557159 (+)
XLOC_004532 NA non-coding upstream 807587 8527568 ~ 8534915 (+)
XLOC_004531 NA non-coding upstream 862037 8477447 ~ 8480465 (+)
XLOC_004527 NA non-coding upstream 1296036 8043521 ~ 8046466 (+)
XLOC_004550 NA non-coding downstream 593806 9941133 ~ 9950489 (+)
XLOC_004556 CU459020.1 non-coding downstream 863605 10210932 ~ 10211048 (+)
XLOC_004565 CR450852.1 non-coding downstream 2296224 11643551 ~ 11643671 (+)

Expression


Co-expression Network