G4799


Basic Information

Item Value
gene id G4799
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053112.1
NCBI id CM020909.1
chromosome length 48724115
location 15735789 ~ 15736178 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU6513
cctccttgcaaaacagctcgagctcagtgaggttggatggagagcgtttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttgtgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcaggga

Function

GO:

id name namespace
GO:0098797 plasma membrane protein complex cellular_component
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU6513 True 390 lncRNA 0.45 1 15735789 15736178

Neighbor

gene id symbol gene type direction distance location
LOC120564766 NA coding downstream 311403 15419252 ~ 15424386 (-)
gpank1 gpank1 coding downstream 320826 15410498 ~ 15414963 (-)
LOC120564677 LOC104962345,LOC107388844,LOC108244157 coding downstream 334344 15395835 ~ 15401445 (-)
foxk1 foxk1 coding downstream 342116 15377200 ~ 15393673 (-)
LOC120557175 NA coding downstream 421884 15312432 ~ 15313905 (-)
LOC120561525 xylt1,LOC102778305 coding upstream 80160 15816338 ~ 15899401 (-)
nomo LOC446065,LOC107089097,LOC105931477,LOC102292868,LOC102196167 coding upstream 258194 15994372 ~ 16034615 (-)
LOC120561637 gsg1l,LOC104954731,LOC103358062 coding upstream 314586 16050764 ~ 16058353 (-)
sec23b LOC100697981,LOC102779165,LOC101466658 coding upstream 328371 16064549 ~ 16078343 (-)
LOC120567135 LOC102194342,LOC101467413,LOC103358059,LOC102294944,LOC100712572 coding upstream 510226 16246404 ~ 16283686 (-)
G4798 NA non-coding downstream 107 15735355 ~ 15735682 (-)
G4797 NA non-coding downstream 4833 15730655 ~ 15730956 (-)
G4729 arpc1b,LOC100695691,LOC102293678,LOC101469153 non-coding downstream 406498 15328188 ~ 15329291 (-)
G4722 arpc1a,LOC102781765 non-coding downstream 414406 15278258 ~ 15321383 (-)
G4713 NA non-coding downstream 472357 15199745 ~ 15263432 (-)
G4815 NA non-coding upstream 45219 15781397 ~ 15781753 (-)
G4860 NA non-coding upstream 257426 15993604 ~ 15994085 (-)
G4881 NA non-coding upstream 311666 16047844 ~ 16048880 (-)
G4886 NA non-coding upstream 313210 16049388 ~ 16049629 (-)
G4915 NA non-coding upstream 459096 16195274 ~ 16257571 (-)
sdk1a sdk1,LOC104962449,LOC103362694 other downstream 50150 15426544 ~ 15685639 (-)
ubl5 ubl5 other downstream 831560 14901146 ~ 14904229 (-)
LOC120555938 LOC103372451,LOC105939179,LOC103462061,LOC108245380 other downstream 1016687 14712144 ~ 14719102 (-)
LOC120558548 pde4a,LOC102299733,LOC102791271 other downstream 1693279 14018902 ~ 14042510 (-)
G4168 NA other downstream 2168523 13531753 ~ 13567266 (-)
LOC120558720 NA other upstream 609540 16345718 ~ 16347922 (-)
LOC120569099 NA other upstream 1675875 17412053 ~ 17421098 (-)
LOC120560175 NA other upstream 1974461 17710639 ~ 17713898 (-)
epn3b LOC102786458,LOC100695148,LOC103373411,LOC101478063,LOC105919984,LOC107373120,LOC108247943,LOC102303243 other upstream 2081329 17817507 ~ 17835761 (-)
LOC120556682 NA other upstream 2099726 17835904 ~ 17848037 (-)

Expression


Co-expression Network