trnac-gca


Basic Information

Item Value
gene id trnac-gca
gene name NA
gene type misc
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053112.1
NCBI id CM020909.1
chromosome length 48724115
location 12860284 ~ 12860355 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>unassigned_transcript_53
GGGGGTATAGCTCAGTGGTGGAGCATTTGACTGCAGATCAAGAGGTCCCTAGTTCAAATCTGGGTGCCGCCT

Function

NR:

description
cilia- and flagella-associated protein 157

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
unassigned_transcript_53 True 72 tRNA 0.55 1 12860284 12860355

Neighbor

gene id symbol gene type direction distance location
LOC120565993 LOC103371372,LOC104925466 coding downstream 57458 12799408 ~ 12802826 (-)
LOC120565245 mpst,LOC102779789 coding downstream 105148 12752362 ~ 12755136 (-)
LOC120561165 NA coding downstream 108855 12727901 ~ 12751429 (-)
LOC120561143 NA coding downstream 139842 12704182 ~ 12720442 (-)
LOC120543530 tmprss6 coding downstream 156503 12688928 ~ 12703781 (-)
ncf4 ncf4 coding upstream 69777 12930132 ~ 12962722 (-)
baiap2l2b baiap2l2,LOC102782181,LOC102312770 coding upstream 117196 12977551 ~ 12989241 (-)
LOC120560412 NA coding upstream 131834 12992189 ~ 13019563 (-)
cbx6a NA coding upstream 183897 13044252 ~ 13068047 (-)
LOC120564587 NA coding upstream 238544 13098899 ~ 13115142 (-)
G3940 NA non-coding downstream 61053 12798811 ~ 12799231 (-)
G3935 NA non-coding downstream 75383 12783201 ~ 12784901 (-)
LOC120555888 NA non-coding downstream 93181 12763447 ~ 12767103 (-)
G3929 rps19bp1,LOC102787703 non-coding downstream 101195 12756475 ~ 12759089 (-)
G3926 NA non-coding downstream 108308 12751755 ~ 12751976 (-)
G3995 NA non-coding upstream 198491 13058846 ~ 13065061 (-)
G4032 NA non-coding upstream 228837 13089192 ~ 13157217 (-)
LOC120567932 NA non-coding upstream 277703 13138058 ~ 13151623 (-)
LOC120567935 NA non-coding upstream 291365 13151720 ~ 13152846 (-)
G4066 NA non-coding upstream 334691 13195046 ~ 13272174 (-)
LOC120561813 NA other downstream 27928 12804502 ~ 12832356 (-)
c1qtnf6b c1qtnf6,LOC103374348 other downstream 200301 12642013 ~ 12659983 (-)
nacc1b nacc1,LOC106946817,LOC106922850 other downstream 1867083 10966362 ~ 10993201 (-)
G3586 LOC104950333 other downstream 1955049 10899558 ~ 10905235 (-)
LOC120559237 LOC103359075 other downstream 2648980 9858080 ~ 10211304 (-)
trnac-gca_1 NA other upstream 1339 12861694 ~ 12861765 (-)
trnac-gca_2 NA other upstream 2175 12862530 ~ 12862601 (-)
trnac-gca_3 NA other upstream 5613 12865968 ~ 12866039 (-)
LOC120560419 LOC103368013,LOC106919771,LOC106522471 other upstream 130209 12990564 ~ 13028393 (-)
LOC120560438 dnal4,LOC108261343,LOC106591471,LOC108436609,LOC108412416 other upstream 176915 13037270 ~ 13040280 (-)

Expression


Co-expression Network