G76445 (LOC103356458,LOC107729795,LOC105006133)



Basic Information


Item Value
gene id G76445
gene name LOC103356458,LOC107729795,LOC105006133
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 27555844 ~ 27565331 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU102268
CTTCTCTGTGTAGATGGGGTTCCTGGAGAGCTCCGACAGATGGACAAATTCGAGGTGAAGGGTCCCAAACTCAGCCAGGATGCTGCTCCCAGCTGAGGCCCAGCCCCAACTCCAACTGGTGCCACTGCTCCCCAGGTTGATGACTCCTCGGGGGATTCCTGTTGGCGTGTTGAAGGCAGGCAGCAGCTTCTCTCCCAGCTCCATTACTTTACTCTTGTACAGCT

Function


NR:

description
PREDICTED: mannosyl-oligosaccharide 1,2-alpha-mannosidase IA-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU102268 True 224 lncRNA 0.57 2 27555844 27565331
Loading

Neighbor


gene id symbol gene type direction distance location
pnrc2 pnrc2,LOC100697533,LOC104941893,LOC101487357 coding upstream 200011 27351851 ~ 27355833 (+)
LOC120561567 mycbp coding upstream 250838 27303310 ~ 27305006 (+)
utp11 utp11 coding upstream 540742 27013093 ~ 27015102 (+)
rspo1 rspo1 coding upstream 600560 26943236 ~ 26955284 (+)
dnali1 dnali1 coding upstream 666009 26886568 ~ 26889835 (+)
si:dkeyp-97a10.3 NA coding downstream 482312 28047643 ~ 28059160 (+)
LOC120562747 LOC103369304,LOC107379318,LOC104956022,LOC100707205,LOC107082966 coding downstream 508859 28074190 ~ 28077263 (+)
etfb etfb coding downstream 697536 28262867 ~ 28272836 (+)
vsig10l NA coding downstream 708742 28274073 ~ 28279197 (+)
LOC120562954 LOC103375369 coding downstream 782279 28347610 ~ 28354162 (+)
G76451 NA non-coding upstream 34331 27520692 ~ 27521513 (+)
G76450 NA non-coding upstream 53487 27501956 ~ 27502357 (+)
G76426 NA non-coding upstream 192832 27362279 ~ 27363012 (+)
G76437 NA non-coding upstream 225804 27327078 ~ 27330040 (+)
G76419 NA non-coding upstream 264412 27290168 ~ 27291432 (+)
G76464 NA non-coding downstream 219864 27785195 ~ 27790404 (+)
G76465 NA non-coding downstream 227441 27792772 ~ 27793211 (+)
G76466 NA non-coding downstream 229221 27794552 ~ 27794873 (+)
G76467 NA non-coding downstream 238431 27803762 ~ 27803961 (+)
G76468 LOC103367060,LOC103388013 non-coding downstream 240287 27805618 ~ 27805835 (+)
G76417 NA other upstream 267387 27284538 ~ 27288457 (+)
G76355 snip1 other upstream 669298 26883450 ~ 26886546 (+)
G76315 NA other upstream 740453 26808118 ~ 26815391 (+)
LOC120562432 LOC101064911,LOC106524684,LOC104919574,LOC106098620,LOC102206486,LOC108235477,LOC102229209,LOC108166993 other upstream 908229 26645384 ~ 26647615 (+)
G76192 NA other upstream 1413217 26139901 ~ 26142627 (+)
fam110d LOC104924711,LOC103367059 other downstream 302113 27867444 ~ 27885464 (+)
G76511 NA other downstream 383552 27948883 ~ 27952580 (+)
ago1 ago1,LOC102230823,LOC103367053,LOC107379324,LOC103388087,LOC107082980,LOC101466039,LOC104959479 other downstream 397359 27962690 ~ 27983714 (+)
LOC120561771 LOC103367052,LOC101466533,LOC107379323,LOC100706402,LOC103139281 other downstream 418722 27984053 ~ 28027526 (+)
G76581 LOC101157563,LOC103369309 other downstream 676452 28241783 ~ 28245161 (+)

Expression


G76445(LOC103356458,LOC107729795,LOC105006133) Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G76445(LOC103356458,LOC107729795,LOC105006133) Expression in each Bioproject

Bar chart with 1 bar.
G76445(LOC103356458,LOC107729795,LOC105006133) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3.
End of interactive chart.

Co-expression Network