G78450 (rrnad1,LOC102779171)



Basic Information


Item Value
gene id G78450
gene name rrnad1,LOC102779171
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 35046927 ~ 35047141 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU104861
CGAGCCCAGCTTGCGGATCTCGTGCTGTTTCTTGGGTTTGACGTGTTTCCTGAATATGTGTCCCAGCAGGGCGCTCTGACTTTGGTTGTGCAGGAACTCCTCAGGCTTCTCCGAGCCGGCCGCCGTGCCTCGCCCCCGCCTGCACTCTCTGGGAAACGCCAGAGCGTGAGCTGTGGCACGGAACGCCAAGAGCGACAGAGGCCACACCGAAGGGT

Function


symbol description
rrnad1 Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human METTL25B (methyltransferase like 25B).

NR:

description
protein RRNAD1 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU104861 True 215 lncRNA 0.62 1 35046927 35047141

Neighbor


gene id symbol gene type direction distance location
isg20l2 isg20l2 coding downstream 2947 35033883 ~ 35043980 (-)
rhbg rhbg2a,LOC106605319 coding downstream 114142 34914321 ~ 34932785 (-)
LOC120562852 NA coding downstream 237078 34807830 ~ 34809849 (-)
mef2d mef2d,LOC103369254,LOC103388711 coding downstream 268322 34634741 ~ 34778605 (-)
LOC120561738 NA coding downstream 446888 34585627 ~ 34600039 (-)
LOC120563201 NA coding upstream 25817 35072958 ~ 35088429 (-)
sri sri,LOC102777834,LOC101483957 coding upstream 55835 35102976 ~ 35110676 (-)
trnap-agg_6 NA coding upstream 86523 35133664 ~ 35133735 (-)
trnap-ugg_1 NA coding upstream 87850 35134991 ~ 35135062 (-)
trnap-cgg_2 NA coding upstream 88949 35136090 ~ 35136161 (-)
G78448 NA non-coding downstream 16081 35030642 ~ 35030846 (-)
G78446 NA non-coding downstream 19346 35027378 ~ 35027581 (-)
G78406 NA non-coding downstream 136354 34910358 ~ 34910573 (-)
LOC120562743 NA non-coding downstream 158681 34869387 ~ 34888246 (-)
G78389 NA non-coding downstream 196497 34844289 ~ 34850430 (-)
G78451 rrnad1 non-coding upstream 6145 35053286 ~ 35054192 (-)
G78452 NA non-coding upstream 10827 35057968 ~ 35058870 (-)
G78459 NA non-coding upstream 42072 35089213 ~ 35089479 (-)
G78491 NA non-coding upstream 72326 35119467 ~ 35120376 (-)
G78494 NA non-coding upstream 78348 35125489 ~ 35128229 (-)
G78444 NA other downstream 32405 35012103 ~ 35014522 (-)
bcan NA other downstream 42594 34974824 ~ 35004333 (-)
G78321 NA other downstream 553732 34492346 ~ 34493195 (-)
LOC120561748 NA other downstream 705946 34339177 ~ 34340981 (-)
LOC120561737 NA other downstream 723912 34316812 ~ 34323015 (-)
G78496 NA other upstream 126725 35173866 ~ 35177239 (-)
plekhf2 plekhf2 other upstream 221216 35268357 ~ 35309397 (-)
G78733 LOC104935873 other upstream 977590 36024731 ~ 36026542 (-)
G79034 dek,LOC100692760,LOC101471355,LOC102210945,LOC102312342 other upstream 1055856 36102997 ~ 36105675 (-)
creb3l4 NA other upstream 1291940 36339081 ~ 36359580 (-)

Expression



Co-expression Network