G78516



Basic Information


Item Value
gene id G78516
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 35206931 ~ 35207166 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU104979
CGGCGGAGGGGCTGCGAGCCAAGCTGCCGCTAACGTTTGATCAGCTTGTTACTCTGGTACTTACAGATCCAGACGTCCGACTAAAATTCCTTCATCCAGTTCAAATAGCAAGCTAAAAACCACCAAGTTCTCAGAAGTGCATCGTAAACACTGGATAAAAATTCAATTTCAGACAACTTCTGGCAGATAACCACAACGCTGACTCAGCACAAAGGCAATATGACACCATCGACAGG

Function


GO:

id name namespace
GO:0050877 nervous system process biological_process
GO:0050953 sensory perception of light stimulus biological_process
GO:0007600 sensory perception biological_process
GO:0007601 visual perception biological_process
GO:0003008 system process biological_process

KEGG:

id description
ko04744 Phototransduction

RNA


RNA id representative length rna type GC content exon number start site end site
TU104979 True 236 lncRNA 0.46 1 35206931 35207166

Neighbor


gene id symbol gene type direction distance location
c7h8orf37 csgr05h8orf37,LOC103366206 coding upstream 5537 35188683 ~ 35201394 (+)
trnas-aga_7 NA coding upstream 18732 35188118 ~ 35188199 (+)
cd83 NA coding upstream 23374 35177408 ~ 35183557 (+)
zgc:113232 LOC103366216 coding upstream 38751 35129114 ~ 35168180 (+)
snrnp48 snrnp48 coding upstream 79220 35119433 ~ 35127711 (+)
wdr73 csgr05h8orf37 coding downstream 981 35208147 ~ 35230312 (+)
LOC120561699 LOC102800167,LOC102194503,LOC101481262,LOC104936483,LOC103358273 coding downstream 150088 35357254 ~ 35362521 (+)
nagpa NA coding downstream 241402 35448568 ~ 35489477 (+)
tp53inp1 NA coding downstream 301167 35508333 ~ 35528009 (+)
ccne2 LOC103358269 coding downstream 327881 35535047 ~ 35546748 (+)
G78488 NA non-coding upstream 33728 35168912 ~ 35173203 (+)
G78440 NA non-coding upstream 175796 35030908 ~ 35031135 (+)
G78366 NA non-coding upstream 288862 34914357 ~ 34918069 (+)
G78219 NA non-coding upstream 548780 34634755 ~ 34658151 (+)
LOC120561766 NA non-coding upstream 701574 34502873 ~ 34505357 (+)
G78518 NA non-coding downstream 23285 35230451 ~ 35230899 (+)
G78519 NA non-coding downstream 24980 35232146 ~ 35232446 (+)
G78524 NA non-coding downstream 32871 35240037 ~ 35240487 (+)
G78525 NA non-coding downstream 35166 35242332 ~ 35242570 (+)
G78527 NA non-coding downstream 37581 35244747 ~ 35244991 (+)
LOC120562567 NA other upstream 350399 34839157 ~ 34856532 (+)
G78200 NA other upstream 662552 34529355 ~ 34544379 (+)
sh3bp5b sh3bp5,LOC102783023 other upstream 1164283 33990542 ~ 34042648 (+)
LOC120562157 NA other upstream 1302646 33894360 ~ 33904285 (+)
bmper bmper other upstream 1327799 33826087 ~ 33879132 (+)
G78594 NA other downstream 198209 35405375 ~ 35408682 (+)
LOC120562275 NA other downstream 536129 35743295 ~ 35773988 (+)
LOC120562279 NA other downstream 658676 35865842 ~ 35888172 (+)
G78759 NA other downstream 903685 36110851 ~ 36190839 (+)
G78772 NA other downstream 1050994 36258160 ~ 36350995 (+)

Expression



Co-expression Network