G79873



Basic Information


Item Value
gene id G79873
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 39398649 ~ 39399288 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU107003
tgtccacttcctcacagcctactgcattgaaccagttccatgtccacttcctcacagcctactgcattgaaccagatccatgtccactttctcacagcctactgcattgaaccagttccatgtccacttcctcacagcctactgcattgaaccagatccatgtccacttcctcacagcctactgcattgaaccagttccatgtccacttcctcacagcctgctgcattgaaccagttccatgtccactttctcacagccttctgcattgaaccagttccatgtccactttctcacagcctactgcattgaaccagatccatgtccacttcctcacagcctactgcattgaaccagttccatgtccactttctcacagcctactgcattgaaccagatccatgtccacttcctcacagcctgctctgcgaaccagttccatgtccacttcctcacagcctactgcattgaaccagatccatgtccacttcctcacagcctactgcattgaaccagttccatgtccacttcctcacagcctactgcattgaaccagttccat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU107003 True 560 lncRNA 0.50 2 39398649 39399288
Loading

Neighbor


gene id symbol gene type direction distance location
LOC120562487 NA coding downstream 255944 39107304 ~ 39142705 (-)
trim33l NA coding downstream 453474 38908049 ~ 38945175 (-)
LOC120563017 NA coding downstream 898992 38489974 ~ 38499657 (-)
LOC120562484 NA coding downstream 913784 38482155 ~ 38484865 (-)
LOC120563005 NA coding downstream 924089 38472146 ~ 38474560 (-)
LOC120562358 LOC101076950 coding upstream 433865 39833153 ~ 39843176 (-)
LOC120562356 ttc24 coding upstream 502477 39901765 ~ 39923149 (-)
LOC120562362 NA coding upstream 726137 40125425 ~ 40175116 (-)
LOC120562374 NA coding upstream 781054 40180342 ~ 40201133 (-)
LOC120562375 NA coding upstream 846097 40245385 ~ 40252154 (-)
G79868 NA non-coding downstream 17006 39380288 ~ 39381643 (-)
G79857 NA non-coding downstream 47996 39323277 ~ 39350653 (-)
G79847 NA non-coding downstream 52219 39279243 ~ 39346430 (-)
G79854 NA non-coding downstream 79407 39318259 ~ 39319242 (-)
G79835 NA non-coding downstream 90909 39196522 ~ 39307740 (-)
G79871 NA non-coding upstream 18542 39417830 ~ 39453240 (-)
G79866 NA non-coding upstream 24669 39423957 ~ 39424691 (-)
G79877 NA non-coding upstream 30150 39429438 ~ 39430275 (-)
G79879 NA non-coding upstream 51180 39450468 ~ 39451237 (-)
G79884 NA non-coding upstream 77358 39476646 ~ 39477473 (-)
G79820 NA other downstream 260267 39097772 ~ 39138382 (-)
G79767 NA other downstream 490628 38906780 ~ 38908021 (-)
nudt17 nudt17 other downstream 718169 38666267 ~ 38680480 (-)
LOC120562485 NA other downstream 876260 38516601 ~ 38522389 (-)
LOC120562482 NA other downstream 1074365 38318944 ~ 38324284 (-)
G80027 NA other upstream 177375 39576663 ~ 39577939 (-)
G80046 NA other upstream 380096 39779384 ~ 39861548 (-)
LOC120562372 NA other upstream 803751 40203039 ~ 40234663 (-)
G80129 NA other upstream 823079 40222367 ~ 40307523 (-)
G80186 NA other upstream 1093035 40492323 ~ 40497596 (-)

Expression


G79873 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G79873 Expression in each Bioproject

Bar chart with 7 bars.
G79873 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network