G80376


Basic Information

Item Value
gene id G80376
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 41650507 ~ 41650950 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU107854
cttttactggtttataaatcactaaacggtttagggccaaaatacatttctgatctgctactacactatgacccacccagacagaaaactgcaggtccgctgcaactctcagttcttttaaatctaagctaaagacctatctttttgatgttgcttttctttaaataatctattaactttaatttcttatactgcactgtaacttttattcttatactgcactatcaattttattcttgtcttttaatgtttttaatttgtttattaatgtttttaaattgttttcaattgtttttaactgctctttaatgttttatgtaaagcactttgaattgccc

Function

GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU107854 True 338 lncRNA 0.29 2 41650507 41650950

Neighbor

gene id symbol gene type direction distance location
LOC120562406 NA coding upstream 74004 41551091 ~ 41576503 (+)
LOC120562396 NA coding upstream 104913 41541090 ~ 41545594 (+)
LOC120562404 NA coding upstream 148848 41500185 ~ 41501659 (+)
LOC120562390 NA coding upstream 330803 41239083 ~ 41319704 (+)
LOC120562388 NA coding upstream 356126 41220084 ~ 41294381 (+)
LOC120561585 NA coding downstream 76616 41727566 ~ 41850702 (+)
LOC120562755 NA coding downstream 876546 42527496 ~ 42529482 (+)
LOC120562768 NA coding downstream 1012568 42663518 ~ 42666003 (+)
LOC120562762 LOC104963449 coding downstream 1113453 42764403 ~ 42768664 (+)
LOC120562761 LOC104963449 coding downstream 1136759 42787709 ~ 42800596 (+)
G80365 NA non-coding upstream 33141 41616909 ~ 41617366 (+)
G80364 NA non-coding upstream 35246 41614100 ~ 41615261 (+)
LOC120562420 NA non-coding upstream 110915 41539010 ~ 41539592 (+)
LOC120562422 NA non-coding upstream 120443 41529063 ~ 41530064 (+)
G80351 NA non-coding upstream 147267 41502345 ~ 41503240 (+)
LOC120561593 NA non-coding downstream 60705 41711655 ~ 41717691 (+)
LOC120561592 NA non-coding downstream 113851 41764801 ~ 41768650 (+)
G80402 NA non-coding downstream 227811 41878761 ~ 41879073 (+)
G80405 NA non-coding downstream 244968 41895918 ~ 41999125 (+)
G80406 NA non-coding downstream 268517 41919467 ~ 42422688 (+)
G80337 NA other upstream 194149 41421356 ~ 41456358 (+)
LOC120562389 NA other upstream 257281 41377447 ~ 41393226 (+)
G80320 NA other upstream 290301 41356480 ~ 41360206 (+)
polr3glb NA other upstream 463562 41156474 ~ 41186945 (+)
LOC120562400 NA other upstream 637888 41007967 ~ 41012619 (+)
LOC120561589 NA other downstream 31463 41682413 ~ 41693005 (+)
G80410 NA other downstream 288548 41939498 ~ 42006594 (+)
G80682 NA other downstream 834385 42485335 ~ 42486009 (+)
LOC120562757 LOC104947480 other downstream 881974 42532924 ~ 42539601 (+)
LOC120562767 NA other downstream 981457 42632407 ~ 42643990 (+)

Expression


Co-expression Network