G80695


Basic Information

Item Value
gene id G80695
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 42561316 ~ 42561622 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU108367
cagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaatcagagtagtctgttactacctgatgaatcagagtaatctgttactacctgatgaatcag

Function

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

RNA

RNA id representative length rna type GC content exon number start site end site
TU108367 True 255 lncRNA 0.38 2 42561316 42561622

Neighbor

gene id symbol gene type direction distance location
LOC120562755 NA coding upstream 31834 42527496 ~ 42529482 (+)
LOC120561585 NA coding upstream 710614 41727566 ~ 41850702 (+)
LOC120562406 NA coding upstream 984813 41551091 ~ 41576503 (+)
LOC120562396 NA coding upstream 1015722 41541090 ~ 41545594 (+)
LOC120562404 NA coding upstream 1059657 41500185 ~ 41501659 (+)
LOC120562768 NA coding downstream 101896 42663518 ~ 42666003 (+)
LOC120562762 LOC104963449 coding downstream 202781 42764403 ~ 42768664 (+)
LOC120562761 LOC104963449 coding downstream 226087 42787709 ~ 42800596 (+)
LOC120562763 LOC106675675,LOC106675676 coding downstream 263976 42825598 ~ 42831659 (+)
LOC120562760 LOC103358480 coding downstream 345394 42907016 ~ 42912785 (+)
G80473 NA non-coding upstream 82252 42362740 ~ 42479064 (+)
G80465 NA non-coding upstream 85062 42338528 ~ 42476254 (+)
G80476 NA non-coding upstream 112343 42374477 ~ 42448973 (+)
G80406 NA non-coding upstream 138628 41919467 ~ 42422688 (+)
G80409 NA non-coding upstream 165529 42046678 ~ 42395787 (+)
G80702 NA non-coding downstream 12372 42573994 ~ 42980107 (+)
LOC120562770 NA non-coding downstream 12439 42574061 ~ 42575485 (+)
G80711 NA non-coding downstream 56038 42617660 ~ 42622605 (+)
G80713 NA non-coding downstream 114315 42675937 ~ 42770719 (+)
G80714 NA non-coding downstream 115754 42677376 ~ 42677864 (+)
LOC120562757 LOC104947480 other upstream 21715 42532924 ~ 42539601 (+)
G80682 NA other upstream 75307 42485335 ~ 42486009 (+)
G80410 NA other upstream 554722 41939498 ~ 42006594 (+)
LOC120561589 NA other upstream 868311 41682413 ~ 41693005 (+)
G80337 NA other upstream 1104958 41421356 ~ 41456358 (+)
LOC120562767 NA other downstream 70785 42632407 ~ 42643990 (+)
LOC120562772 NA other downstream 221873 42783495 ~ 42786405 (+)

Expression


Co-expression Network