G80714


Basic Information

Item Value
gene id G80714
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 42677376 ~ 42677864 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU108416
atgaaccagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaatcagagtaatctgttactacctgatgaaccagagtaatctgttactacctgatgaatcagagta

Function

NR:

description
PREDICTED: LOW QUALITY PROTEIN: son of sevenless homolog 1, partial

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

RNA

RNA id representative length rna type GC content exon number start site end site
TU108416 True 405 lncRNA 0.37 2 42677376 42677864

Neighbor

gene id symbol gene type direction distance location
LOC120562768 NA coding upstream 11373 42663518 ~ 42666003 (+)
LOC120562755 NA coding upstream 147894 42527496 ~ 42529482 (+)
LOC120561585 NA coding upstream 826674 41727566 ~ 41850702 (+)
LOC120562406 NA coding upstream 1100873 41551091 ~ 41576503 (+)
LOC120562396 NA coding upstream 1131782 41541090 ~ 41545594 (+)
LOC120562762 LOC104963449 coding downstream 86539 42764403 ~ 42768664 (+)
LOC120562761 LOC104963449 coding downstream 109845 42787709 ~ 42800596 (+)
LOC120562763 LOC106675675,LOC106675676 coding downstream 147734 42825598 ~ 42831659 (+)
LOC120562760 LOC103358480 coding downstream 229152 42907016 ~ 42912785 (+)
G80711 NA non-coding upstream 54771 42617660 ~ 42622605 (+)
LOC120562770 NA non-coding upstream 101891 42574061 ~ 42575485 (+)
G80695 NA non-coding upstream 115754 42561316 ~ 42561622 (+)
G80473 NA non-coding upstream 198312 42362740 ~ 42479064 (+)
G80465 NA non-coding upstream 201122 42338528 ~ 42476254 (+)
G80717 NA non-coding downstream 18761 42696625 ~ 42743653 (+)
LOC120562769 NA non-coding downstream 41552 42719416 ~ 42720854 (+)
G80719 NA non-coding downstream 62962 42740826 ~ 42758626 (+)
LOC120562780 NA non-coding downstream 101091 42778955 ~ 42780523 (+)
LOC120562781 NA non-coding downstream 164711 42842575 ~ 42845934 (+)
LOC120562767 NA other upstream 33386 42632407 ~ 42643990 (+)
LOC120562757 LOC104947480 other upstream 137775 42532924 ~ 42539601 (+)
G80682 NA other upstream 191367 42485335 ~ 42486009 (+)
G80410 NA other upstream 670782 41939498 ~ 42006594 (+)
LOC120561589 NA other upstream 984371 41682413 ~ 41693005 (+)
LOC120562772 NA other downstream 105631 42783495 ~ 42786405 (+)

Expression


Co-expression Network