G72796


Basic Information

Item Value
gene id G72796
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 16482255 ~ 16482498 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU97227
tacataacaaagtagagggaggcaggccagccaagccagatccggcagggggagagttctaagcccgaaaaagctacctctccttatgacctgtctctcttagttacctgttatagttacgctgttatagtcctagactgccgggggacttccttcctttgacacactgagctgctctctcctctccctttctattactgttactattactattactatttgtgtgcagcccatcccagaaatg

Function

GO:

id name namespace
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU97227 True 244 lncRNA 0.48 1 16482255 16482498

Neighbor

gene id symbol gene type direction distance location
LOC120563110 dcdc2,LOC102296430,LOC102788673 coding upstream 774753 15682419 ~ 15707502 (+)
slc6a3 slc6a3 coding upstream 807033 15657241 ~ 15675222 (+)
LOC120562533 lpcat1,LOC103360438,LOC100699650 coding upstream 829203 15619516 ~ 15653052 (+)
irx2a irx2,LOC102783739 coding upstream 1068208 15408178 ~ 15414047 (+)
trnae-cuc_16 NA coding upstream 1455602 15026582 ~ 15026653 (+)
mboat1 mboat1 coding downstream 13228 16495726 ~ 16508741 (+)
LOC120562688 tnfrsf11b,LOC103369092 coding downstream 150378 16632876 ~ 16718524 (+)
LOC120562690 NA coding downstream 239138 16721636 ~ 16724556 (+)
LOC120562939 NA coding downstream 243850 16726348 ~ 16729348 (+)
LOC120562315 NA coding downstream 250134 16732632 ~ 16816257 (+)
G72795 e2f3 non-coding upstream 323 16480679 ~ 16481932 (+)
G72775 NA non-coding upstream 300325 16175094 ~ 16181930 (+)
LOC120562129 NA non-coding upstream 473121 15969177 ~ 16009134 (+)
G72705 NA non-coding upstream 634935 15844310 ~ 15847320 (+)
G72704 NA non-coding upstream 637317 15836962 ~ 15844938 (+)
G72797 NA non-coding downstream 3215 16485713 ~ 16485919 (+)
G72798 e2f3 non-coding downstream 7095 16489593 ~ 16490381 (+)
G72801 NA non-coding downstream 11739 16494237 ~ 16494575 (+)
G72852 NA non-coding downstream 248339 16730837 ~ 16731044 (+)
G72859 NA non-coding downstream 477290 16959788 ~ 16962840 (+)
G72750 LOC104952694,LOC106925895 other upstream 410054 16018359 ~ 16072201 (+)
irx4a LOC103360443,LOC102233360,LOC103478376,LOC108232226,LOC101474805,LOC102784018,LOC102295185,LOC102202030,LOC104961814,LOC103145173 other upstream 921963 15553464 ~ 15560292 (+)
LOC120561718 LOC107101581 other upstream 1849534 14626478 ~ 14632721 (+)
G72506 NA other upstream 2056075 14425794 ~ 14426180 (+)
LOC120562174 rbms3,LOC101066789,LOC103370884 other upstream 2112164 14175817 ~ 14370091 (+)
G73031 LOC103366415 other downstream 967087 17449585 ~ 17452568 (+)
ubxn11 NA other downstream 974145 17456643 ~ 17461118 (+)
G73123 phactr4 other downstream 1163015 17645513 ~ 17647186 (+)
paqr7b LOC107588505,LOC104938075,LOC103388542 other downstream 1268432 17750930 ~ 17779130 (+)
kcnn4 kcnn4,LOC104953880,LOC100704922 other downstream 1916558 18399056 ~ 18420721 (+)

Expression


Co-expression Network