LOC120562054


Basic Information

Item Value
gene id LOC120562054
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 17500589 ~ 17504921 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>XR_005639682.1
CTCAAAGTCCACATGCTCCTGGGCCAGACCCAAGATGAAGAGCGGTGCCCAGCAGCTTTTAAGAAGTGCAAACTGGTCATTTGATGGCATCTGGTTAAACGCAGCCAAGAAGCATGAAACCATCATCATGGAAGTTCTAGAGGAAGATCTGAACCACAGAGCACTGTGGTGCCAAGTTTTCCCAGGTCATTGAACTCAGTGCGTGATGAACACCGTGTCTGGACCATGACAACTGACCTTGACCTACTGCTAATACAGCAGAGGTTCATCTGCCAAGGTCATTACCCCAAAGGTGACGGCTATTCTTACACCGTGGCGGTCATTTCAATCCTCAGGAAAAATTATTTATCCTGGAATTTGAAATTGAGTGAATTCAC

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0043401 steroid hormone mediated signaling pathway biological_process
GO:0005634 nucleus cellular_component
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0003707 steroid hormone receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_005639682.1 True 377 lncRNA 0.47 3 17500589 17504921

Neighbor

gene id symbol gene type direction distance location
kdf1a kdf1,LOC104937957 coding upstream 2856 17492444 ~ 17497733 (+)
LOC120562050 LOC103366409 coding upstream 8648 17489596 ~ 17491941 (+)
LOC120562051 tmem222 coding upstream 11115 17486166 ~ 17489474 (+)
wdtc1 wdtc1,LOC102795681 coding upstream 15736 17475568 ~ 17484853 (+)
cdcp1a NA coding upstream 55395 17439093 ~ 17445194 (+)
gpatch3 gpatch3 coding downstream 4135 17509056 ~ 17512860 (+)
gpn2 gpn2 coding downstream 8106 17513027 ~ 17517296 (+)
arid1aa arid1a coding downstream 15083 17520004 ~ 17535611 (+)
pigv pigv coding downstream 31609 17536530 ~ 17539422 (+)
zdhhc18a zdhhc18,LOC100695947,LOC102211057 coding downstream 36136 17541057 ~ 17550194 (+)
G73027 NA non-coding upstream 37562 17427828 ~ 17463027 (+)
G73019 NA non-coding upstream 96962 17392268 ~ 17403627 (+)
trnar-acg_16 NA non-coding upstream 131814 17368703 ~ 17368775 (+)
G72862 NA non-coding upstream 434678 17065589 ~ 17065911 (+)
G72879 NA non-coding upstream 508600 16991716 ~ 16991989 (+)
G73186 NA non-coding downstream 419029 17923950 ~ 17926628 (+)
G73216 NA non-coding downstream 609794 18114715 ~ 18116323 (+)
G73230 LOC104960016 non-coding downstream 620073 18124994 ~ 18127318 (+)
G73231 NA non-coding downstream 622502 18127423 ~ 18127887 (+)
G73232 NA non-coding downstream 624098 18129019 ~ 18129219 (+)
ubxn11 NA other upstream 39471 17456643 ~ 17461118 (+)
G73031 LOC103366415 other upstream 48021 17449585 ~ 17452568 (+)
G72750 LOC104952694,LOC106925895 other upstream 1428388 16018359 ~ 16072201 (+)
irx4a LOC103360443,LOC102233360,LOC103478376,LOC108232226,LOC101474805,LOC102784018,LOC102295185,LOC102202030,LOC104961814,LOC103145173 other upstream 1940297 15553464 ~ 15560292 (+)
LOC120561718 LOC107101581 other upstream 2867868 14626478 ~ 14632721 (+)
G73123 phactr4 other downstream 140592 17645513 ~ 17647186 (+)
paqr7b LOC107588505,LOC104938075,LOC103388542 other downstream 246009 17750930 ~ 17779130 (+)
kcnn4 kcnn4,LOC104953880,LOC100704922 other downstream 894135 18399056 ~ 18420721 (+)
LOC120562807 NA other downstream 950653 18455574 ~ 18461326 (+)
LOC120562806 NA other downstream 961507 18466428 ~ 18470078 (+)

Expression


Co-expression Network