Fish Transcriptome and Expression Database

trnai-aau_11

Item	Value
gene id	trnai-aau_11
gene name	NA
gene type	coding
species	eurasian perch (Perca fluviatilis)
category of species	economic fish

Item	Value
chromosome id	NC_053118.1
NCBI id	CM020915.1
chromosome length	43092710
location	24468 ~ 24541 (-)
genome version	GENO_Pfluv_1.0_2020_eurasian_perch_Genome

>unassigned_transcript_286
GGCCGGTTAGCTCAGATGGTTAGAGCGTGGTGCTAATAACGCCAAGGTCATGGGTTCGATCCCCATACTGGCCA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
unassigned_transcript_286	True	74	tRNA	0.55	1	24468	24541

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

gene id	symbol	gene type	direction	distance	location
trnai-aau_10	NA	coding	downstream	969	23426 ~ 23499 (-)
trnai-aau_9	NA	coding	downstream	2014	22381 ~ 22454 (-)
trnar-ucg_4	NA	coding	downstream	2372	22024 ~ 22096 (-)
trnai-aau_8	NA	coding	downstream	3059	21336 ~ 21409 (-)
trnar-ucg_3	NA	coding	downstream	4448	19948 ~ 20020 (-)
trnar-ucg_5	NA	coding	upstream	615	25156 ~ 25228 (-)
trnai-aau_12	NA	coding	upstream	972	25513 ~ 25586 (-)
trnar-ucg_6	NA	coding	upstream	1659	26200 ~ 26272 (-)
trnai-aau_13	NA	coding	upstream	2016	26557 ~ 26630 (-)
trnar-ucg_7	NA	coding	upstream	2704	27245 ~ 27317 (-)
G69532	NA	non-coding	upstream	34087	58628 ~ 60100 (-)
G69539	NA	non-coding	upstream	130533	155074 ~ 155292 (-)
G69541	NA	non-coding	upstream	193287	217828 ~ 233498 (-)
G69564	NA	non-coding	upstream	222147	246688 ~ 246940 (-)
G69615	NA	non-coding	upstream	318046	342587 ~ 343038 (-)
osr2	osr2	other	upstream	703944	728485 ~ 732756 (-)
zfpm2a	zfpm2	other	upstream	1700617	1725158 ~ 1861166 (-)
usp45	usp45	other	upstream	2702627	2727168 ~ 2818027 (-)
G70407	NA	other	upstream	3604592	3629133 ~ 3629818 (-)
LOC120563202	NA	other	upstream	3954770	3979311 ~ 3979414 (-)