G85011 (ppp6r2)


Basic Information

Item Value
gene id G85011
gene name ppp6r2
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053119.1
NCBI id CM020916.1
chromosome length 42187026
location 15062611 ~ 15063137 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU114476
AGCACATTCAGCAAAGGGTCAGGCTGTGAAATCTCTTGGAGCTGATTGGCCTGGTCTCGGCTTAGACGAATGATGTCACACAATGTCTGAGATGCATTGGACTGCCTCTCTTCATCTCTTTCAGGGTGAATGAGCTCTACGAGTCTCTGGGCCAGCTTCTCTTCATTCAGCCAAATAAGTGTCTCAAGCCGAAGAGGGGGTGGCTCCACACAGCTGATAAGTCTTAGGAGCACATCCATCATGGCTGATGTATCAATATGCTTCAGGACCAAGGAAAGGAAGCCATCCTTCTGTCGCAGAAAACTAATCAC

Function

symbol description
ppp6r2 Predicted to enable protein phosphatase regulator activity. Predicted to be involved in regulation of phosphoprotein phosphatase activity. Located in cytosol and intracellular membrane-bounded organelle.

NR:

description
PREDICTED: serine/threonine-protein phosphatase 6 regulatory subunit 2 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU114476 True 311 lncRNA 0.49 3 15062611 15063137

Neighbor

gene id symbol gene type direction distance location
dnaja2b dnaja2,LOC103370603,LOC100703595,LOC101465466 coding downstream 5481 15051850 ~ 15057130 (-)
LOC120563916 NA coding downstream 49795 15004301 ~ 15012816 (-)
LOC120563915 LOC103375945,LOC104957331,LOC101467291,LOC102310371 coding downstream 72097 14973281 ~ 14990514 (-)
elapor2a kiaa1324l,LOC104944050 coding downstream 143335 14903173 ~ 14919276 (-)
sema3d sema3d coding downstream 267481 14757979 ~ 14795130 (-)
lmf2a lmf2,LOC102783784 coding upstream 35489 15098626 ~ 15105742 (-)
c2cd5 NA coding upstream 42934 15106071 ~ 15131264 (-)
b4galnt3b LOC103133797,LOC106915345 coding upstream 76304 15139441 ~ 15158824 (-)
fkbp4 fkbp4 coding upstream 100416 15163553 ~ 15172203 (-)
wash1 wash1,LOC102303465,LOC101485180 coding upstream 119472 15182609 ~ 15189986 (-)
G85007 NA non-coding downstream 4682 15057725 ~ 15057929 (-)
G84948 NA non-coding downstream 107204 14954128 ~ 14955407 (-)
G84971 NA non-coding downstream 210588 14851720 ~ 14852023 (-)
LOC120564774 NA non-coding downstream 254543 14807411 ~ 14808068 (-)
G84960 NA non-coding downstream 495342 14558458 ~ 14567269 (-)
G85027 NA non-coding upstream 115203 15178340 ~ 15179173 (-)
G85084 NA non-coding upstream 298700 15361837 ~ 15363425 (-)
LOC120563611 NA non-coding upstream 390072 15453209 ~ 15455514 (-)
G85121 LOC103364747,LOC103358513 non-coding upstream 392518 15455655 ~ 15458913 (-)
LOC120563610 NA non-coding upstream 392703 15455840 ~ 15456554 (-)
si:ch1073-390k14.1 LOC103375950 other downstream 94828 14961860 ~ 14967783 (-)
LOC120563775 cacna2d1,LOC104952157 other downstream 504383 14501896 ~ 14558228 (-)
LOC120564470 NA other downstream 825659 14223197 ~ 14236952 (-)
zgc:77752 NA other downstream 1024895 14031104 ~ 14037716 (-)
mafb maf,LOC104941368,LOC104940469,LOC101071510,LOC101484138,LOC103380135,LOC102219741,LOC106520304 other downstream 1443825 13573831 ~ 13618786 (-)
G85014 ppp6r2,LOC103370604 other upstream 2902 15066039 ~ 15073350 (-)
ttc23 LOC104957250 other upstream 409797 15472934 ~ 15484145 (-)
G85133 mef2a,mef2aa,LOC107553916 other upstream 451641 15514778 ~ 15544082 (-)
chd2 chd2 other upstream 1092847 16155984 ~ 16187336 (-)
st8sia2 fam174b,st8sia2,LOC100690985,LOC101474125,LOC102798331 other upstream 1125716 16188853 ~ 16209186 (-)

Expression


Co-expression Network